Variant Exons v6 and v7 Together Expand the Repertoire of Glycosaminoglycans Bound by CD44

Abstract

Isoforms of the glycoprotein CD44 are cell surface receptors for the glycosaminoglycan hyaluronate. They have been implicated in many biological processes, but their function in these is poorly understood and cannot be explained solely by hyaluronate binding. In the present work we examine the ligand binding properties of alternatively spliced CD44 variant isoforms which are functionally involved in the immune system, embryonic development, and tumor behavior. We show that these isoforms bind directly to the purified glycosaminoglycans chondroitin sulfate, heparin, and heparin sulfate, in addition to being able to bind to hyaluronate. Binding to this extended repertoire of glycosaminoglycans by CD44 depends on the inclusion of peptide sequences encoded by the alternatively spliced exons v6 and v7, and occurs both when the CD44 is solubilized from the plasma membrane and when it is expressed on intact cells. A single point mutation in the most N-terminal hyaluronate binding motif of CD44 ablates both hyaluronate and chondroitin sulfate binding, suggesting that glycosaminoglycans are bound through a common motif, and that only one of the hyaluronate binding motifs is responsible for the majority of glycosaminoglycan binding by CD44 on the cell surface. Taken together, these observations indicate that alternative splicing regulates the ligand binding specificity of CD44 and suggest that structural changes in the CD44 protein have a profound effect on the range of ligands to which this molecule can bind with potentially wide-ranging functional consequences.

Expression of CD44 variant exons in acute myeloid leukemia is more common and more complex than that observed in normal blood, bone marrow or CD34+ cells

“…CD44 containing exons v6 and v7 in the one CD44 molecule have an increased repertoire of glycosaminoglycan ligands. 32 Neither exon expressed alone has this effect. These results emphasise the importance of the exon combinations rather than the effect of individual exons in the function of CD44.…”

“…7 The insertion of variant exons into the membrane proximal region can modify the adhesive function of CD44 and could therefore modify the interactions between hematopoietic progenitors and the bone marrow stroma. 22,32 Exons v8-v10 have been detected in normal hematopoietic cells. 12,23 In addition to exons v8-v10 we have detected mRNA containing exons v3 and v6 alone in normal resting bone marrow mononuclear cells, peripheral blood lymphocytes and CD34 + progenitors.…”

Hepatocyte Growth Factor-induced Ras Activation Requires ERM Proteins Linked to Both CD44v6 and F-Actin

“…The fusion protein containing the F-actin binding domain rather enhanced c-Met signaling. Note, however, that c-Met activa- Figure 3B), a fusion construct between CD44v6 and ezrin lacking the last 34 C-terminal amino acids (ez⌬ABD), or a CD44v6 full length construct (pGKs6; Sleeman et al, 1997) together with HA-Erk and detection of HGF induced HA-Erk phosphorylation. The -fold induction by HGF is indicated.…”

“…Expression vectors containing rat CD44v6 fused to full-length or truncated rat ezrin: The CD44 part was amplified by polymerase chain reaction (PCR) covering the 5Ј-untranslated region to the transmembrane domain from the pGKs6 vector (Sleeman et al, 1997). The primers used were CGCGACCCTTT-TCCAGAGGCTACTAGATCCTTTGG TTTCATCCTGCACATCATGG and GTCTGCATTGCTGTCAACAGTAGGAGG AAGCAGACGTAACGACAGT-TGTCATCCTCCTTCCTTTGGAAAC.…”

CD44 variant exon v5 encodes a tyrosine that is sulphated

“…It has also been shown that alternative splicing can modulate the affinity of CD44 for hyaluroare spliced out encode the most common and widely expressed 85-kDa isoform (CD44s). Further diversity is introduced into nate [16Ϫ18] and induce binding of the protein to other GAF through the hyaluronate-binding motif [18]. Furthermore, an anthe CD44 family of proteins by O-linked and N-linked sugar tibody specific for CD44 variant isoforms containing an exonmodifications and by glycosaminoglycan (GAG) additions [2].…”