Vancomycin-Resistant Staphylococcus aureus Isolates Associated with Inc18-Like vanA Plasmids in Michigan

Abstract

Five of the seven cases of vancomycin-resistant Staphylococcus aureus (VRSA) infection identified to date have occurred in southeastern Michigan. VRSA isolates from the four most recent cases (all from Michigan) were characterized. The vanA gene was localized to a single plasmid in each VRSA isolate. The pulsed-field gel electrophoresis patterns of chromosomal DNA and the restriction profile of the plasmid demonstrated that the four isolates were unique and differed from the first three VRSA isolates. Vancomycin-resistant Enterococcus (VRE) isolates, all of which were Enterococcus faecalis, were recovered from case patients 4 to 6. Each VRE isolate transferred vancomycin resistance to E. faecalis JH2-2 by conjugation. PCRs for vanA and the Inc18-like plasmid genes traA and repR confirmed the presence of an Inc18-like vanA plasmid in all VRE isolates and transconjugants. An Inc18-like vanA plasmid was identified in the VRSA isolate from case patient 7. These findings suggest a role of Inc18-like plasmids as vanA donors.

Current Trends of Emergence and Spread of Vancomycin-Resistant Enterococci

“…This has been confirmed by molecular analysis of the corresponding vanA-type plasmids from related VRSA and MRSA isolates (Weigel et al, 2003;Clark et al, 2005;Zhu et al, 2008). The VRSA isolate contained a 58 kb conjugative plasmid pLW1043, the MRSA a ca.…”

“…It showed a mosaic-like structure, but the backbone was similar to staphylococcal type pSK41 plasmids and different from typical enterococcal plasmids suggesting acquisition of the vanA cluster by a resident staphylococcal-type plasmid (Kwong et al, 2008;Weaver et al, 2009). Interestingly, majority of other VRSA and co-colonising VRE isolates contained inc18-type vanA plasmids investigated in a follow up study (Zhu et al, 2008). The inc18-type plasmids represent broad-host range plasmids widely prevalent among Gram-positive bacteria of different enterococcal, staphylococcal and streptococcal species (Weaver et al, 2009).…”

“…Plasmids from three VRSA cases were sequenced [plasmids pWZ7140 (47,277 bp), pWZ909 (42,602 bp), and pWZ1668 (48,365 bp)]. They were almost identical among each other and to a corresponding vanA plasmid from co-colonising E. faecalis strains revealing a possible direct transfer from an E. faecalis donor into MRSA (Zhu et al, 2008). Molecular studies with isogenic MRSA and VRSA isolates revealed that acquired VanA-type resistance was highly costly to the host, when induced ).…”

A type III-like restriction endonuclease functions as a major barrier to horizontal gene transfer in clinical Staphylococcus aureus strains

“…In bacteria of medical importance, such as the opportunistic pathogen S. aureus, the transfer of antibiotic resistance and virulence genes represents a major concern. The discovery of the transfer of the vancomycinresistance gene vanA on transposon Tn1546 harbored by enterococci to S. aureus demonstrates the importance of HGT (5,35). Similarly, several decades after the identification of the genetic basis of methicillin resistance in S. aureus, the origin of the SCCmec element and its transfer are neither established nor fully understood.…”

Wounds, Functional Disability, and Indwelling Devices Are Associated With Cocolonization by Methicillin-Resistant Staphylococcus aureus and Vancomycin-Resistant Enterococci in Southeast Michigan

“…For identification of Inc18-like plasmids, PCR was performed with primer pairs: vanA F: catgaatagaataaaagttgctgcaata and vanA R: cccctttaacgctaatacgatcaa; traA F: taatcgcaatggcttcttatc and traA R: tctgcccaatctttacgaat; and repR F: gcttcatgacggcttgtta and repR R: ttggctgctttgacagattta [15]. PCR was performed in 50-lL reactions with 1-lL colony resuspended in sterile dH 2 O as template.…”