Value of FOXP3 Expression in Peripheral Blood as Rejection Marker After Miniature Swine Lung Transplantation

Satoda, Naoki; Tanaka, Shōji; Wu, Yanling; Fujinaga, Takuji; Chen, Fengshi; Aoyama, Akihiro; Zhang, Ji Tian; Takahashi, Ayuko; Okamoto, Toshihiro; Matsumoto, Izumi; Sakai, Hiroaki; Liu, Ying; Zhao, Xiangdong; Manabe, Toshiaki; Kobayashi, Eiji; Sakaguchi, Shimon; Wada, Hiromi; Ohe, Hidenori; Üemoto, Shinji; Tottori, Junichi; Bando, Toru; Date, Hiroshi; Koshiba, T

doi:10.1016/j.healun.2008.08.006

Cited by 7 publications

(5 citation statements)

References 46 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Foxp3 is currently considered to be the most specific marker for Treg. Satoda et al [16] recently revealed that Foxp3 in peripheral blood cells is upregulated in the early phase of rejection in a porcine model. This finding would appear to contradict those of the present and previous studies [17]; however, our rejection recipients were diagnosed from POD 12 to 14 and subsequently received high-dose immunosuppressive therapy for 3 days.…”

Section: Discussionmentioning

confidence: 99%

“…cells in the group with improving lung function. Previous studies indicated that cellular immune response associated with acute rejection of allograft lungs and other solid organs is characterized by the local production of Th1 but not Th2 cytokines [15,16]. Tregs have been found to be pivotal for the induction of these suppressor IL-10 secreting T cells [27].…”

Section: Discussionmentioning

confidence: 99%

See 1 more Smart Citation

Lung function early after lung transplantation is correlated with the frequency of regulatory T cells

et al. 2011

View full text Add to dashboard Cite

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Discussionmentioning

confidence: 99%

Lung function early after lung transplantation is correlated with the frequency of regulatory T cells

et al. 2011

View full text Add to dashboard Cite

show abstract

“…We reported the characteristics of transgenic pigs with incorporated marker genes which are required for in vivo tracking of cells in various cell-therapy researches [ 8 , 13 , 18 ]. We further developed a porcine model as non-clinical and clinical integrated model to verify the function of platelets and T cells [ 4 , 15 ]. We have established porcine iPS cells [ 2 ] and reported their MHC-matched allogeneic transplantation [ 12 ].…”

Section: Construction Of a Center Allowing Non-clinical And Clinical mentioning

confidence: 99%

Swine used in the medical university: overview of 20 years of experience

2018

Self Cite

View full text Add to dashboard Cite

Center for Development of Advanced Medical Technology (CDAMTec) in Jichi Medical University was established in 2009. It is the first educational research facility specialized for medical research and training using swine in Japan. Preclinical studies on large animals are essential prior to clinical trials to develop regenerative medical products and medical equipment. We have continued comprehensively considering using miniature swine for experiments to develop advanced medical technologies and train physicians with advanced clinical abilities, while paying attention to animal welfare. The center plays a pioneering role in this field by accumulating know-how such as (1) Construction and effective utilization of research facilities, (2) Procurement of quality animal resources, (3) Education and training of technical staff, (4) Establishment of support system for physicians and researchers. We now open up widely these expertise and foundation for medical research and training not only within our university but also outside the university, so as to move faster to practical use of advanced medical technology and contribute to human health and welfare.

show abstract

“…(Roche) with the following primers [23,24]: FOXP3 sense TTCCCA-GACTTTCTTTCACAACAT, antisense GCTGCTTCTCTGGAGCCTCCAG; IFN-␥ sense TGGTAGCTCTGGGAAACTGAATG, antisense GGCTTT-GCGCTGGATCTG; GAPDH sense GTGGAGTCCACTGGTGTCTTCACG, antisense AACTCCCTCTAACAGTATGAAGAG.…”

Section: Apoptosis Assaymentioning

confidence: 99%

Human PD-L1-overexpressing porcine vascular endothelial cells induce functionally suppressive human CD4+CD25hiFoxp3+ Treg cells

Ding

Zhou

et al. 2011

Journal of Leukocyte Biology

View full text Add to dashboard Cite

In xenotransplantation models, direct activation of hCD4(+) T cells by porcine VECs leads to a robust proliferation of T cells. To investigate the underlying mechanisms, human antiporcine MLEC culture was used to investigate cross-species cell interactions, proliferation of hCD4(+) T cells, and induction of human cytokines. We report that xenoantigen presentation by PIEC expands hCD4(+) Foxp3(+) Tregs and hCD4(+) Foxp3(-) Teffs, and this process is dependent on porcine MHC-II antigen expression. Stable transfection of hPD-L1 into PIEC inhibits Teff proliferation, but Treg proliferation is not affected. Surprisingly, IL-10 production by hCD4(+) T cells is augmented significantly by PIEC(hPD-L1). Notably, hPD-L1-induced Tregs have higher suppressive potency and mediate suppressive function partially through IL-10 and CD73. This study opens the possibility of using hPD-L1-overexpressing porcine VECs as a novel therapeutic to allow tolerance of xenotransplants and also supports the possibility of using hPD-L1 transgenic pigs as xenotransplant donors.

show abstract

Value of FOXP3 Expression in Peripheral Blood as Rejection Marker After Miniature Swine Lung Transplantation

Abstract: In a miniature swine lung transplantation model, the FOXP3 mRNA level in the peripheral blood was upregulated at an early phase of rejection. The clinical implication of this finding remains to be elucidated.

Cited by 7 publications

References 46 publications

Lung function early after lung transplantation is correlated with the frequency of regulatory T cells

Lung function early after lung transplantation is correlated with the frequency of regulatory T cells

Swine used in the medical university: overview of 20 years of experience

Human PD-L1-overexpressing porcine vascular endothelial cells induce functionally suppressive human CD4+CD25hiFoxp3+ Treg cells

Contact Info

Product

Resources

About