Validation of reference genes for the normalization of RT-qPCR expression studies in human tongue carcinoma cell lines and tissue

Liu, Xin; Liu, Cong; Ren, Mingchun; Gao, Sujie; Zhao, Guogang; Zhang, Tianfu; Yang, Qiwei

doi:10.3892/ol.2017.5887

Cited by 6 publications

(7 citation statements)

References 24 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Reverse transcription reactions were performed using the T100 Thermal Cycler (Bio-Rad). Samples were analyzed by qPCR in triplicate using the iTaq Universal SYBR Green Supermix (Bio-Rad), run on the CFX96 Real-Time PCR Detection System (Bio-Rad) using previously described primers for RPS18 (forward: ATTGCCGACAGGATGCAGAA, reverse: GCTGATCCACATCTGCTGGAA), Mcl-1 (forward: TGATCCATGTTTTCAGCGAC, reverse: AATGGTTCGATGCAGCTTTC), Bcl-2 (forward: GATGTGATGCCTCTGCGAAG, reverse: GATGTCTCTGGAATCT), and survivin (forward: ACCGCATCTCTACATTCAAG, reverse: CAAGTCTGGCTCGTTCTC) [ 36 , 37 , 38 , 39 ]. Calibration curves using serial dilutions of cDNA were plotted, and gene expression was quantified by plotting threshold cycle values.…”

Section: Methodsmentioning

confidence: 99%

Dinaciclib, a Bimodal Agent Effective against Endometrial Cancer

Howard

James

Murphy

et al. 2021

Cancers

View full text Add to dashboard Cite

Endometrial cancer (EC) is the sixth most prevalent female cancer globally and although high rates of success are achieved when diagnosed at an early stage, the 5-year survival rate for cancers diagnosed at Stages II–IV is below 50%. Improving patient outcomes will necessitate the introduction of novel therapies to the clinic. Pan-cyclin-dependent kinase inhibitors (CDKis) have been explored as therapies for a range of cancers due to their ability to simultaneously target multiple key cellular processes, such as cell cycle progression, transcription, and DNA repair. Few studies, however, have reported on their potential for the treatment of EC. Herein, we examined the effects of the pan-CDKi dinaciclib in primary cells isolated directly from tumors and EC cell lines. Dinaciclib was shown to elicit a bimodal action in EC cell lines, disrupting both cell cycle progression and phosphorylation of the RNA polymerase carboxy terminal domain, with a concomitant reduction in Bcl-2 expression. Furthermore, the therapeutic potential of combining dinaciclib and cisplatin was explored, with the drugs demonstrating synergy at specific doses in Type I and Type II EC cell lines. Together, these results highlight the potential of dinaciclib for use as an effective EC therapy.

show abstract

Section: Methodsmentioning

confidence: 99%

Dinaciclib, a Bimodal Agent Effective against Endometrial Cancer

Howard

James

Murphy

et al. 2021

Cancers

View full text Add to dashboard Cite

show abstract

“…However, their stability varies under different experimental conditions [ 16 , 17 ]. Moreover, several studies had reported that there is no single reference gene that can maintain its expression level in different experimental conditions [ 18 – 20 ]. Typically, internal control genes show variability in expression levels in different tissues, emphasizing the importance of identification for normalization reference validation selection.…”

Section: Introductionmentioning

confidence: 99%

Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells

Smith

Sun

et al. 2018

BioMed Research International

View full text Add to dashboard Cite

Endothelial cells (ECs) could express some important cytokines and signal molecules which play a key role in normal hematopoiesis and repopulation. Busulfan-induced vascular endothelial injury is an important feature after hematopoietic stem cell transplantation (HSCT). But the molecular mechanism of how the injured ECs affect hematopoietic reconstruction is still unknown. It is possibly through modulation of the change of some gene expression. RT-qPCR is one of the most popular methods used to accurately determine gene expression levels, based on stable reference gene (RG) selection from housekeeping genes. So our aim is to select stable RGs for more accurate measures of mRNA levels during Busulfan-induced vascular endothelial injury. In this study, 14 RGs were selected to investigate their expression stability in ECs during 72 hours of EC injury treated with Busulfan. Our results revealed extreme variation in RG stability compared by five statistical algorithms. ywhaz and alas1 were recognized as the two idlest RGs on account of the final ranking, while the two most usually used RGs (gapdh and actb) were not the most stable RGs. Next, these data were verified by testing signalling pathway genes ctnnb1, robo4, and notch1 based on the above four genes ywha, alas1, gapdh, and actb. It shows that the normalization of mRNA expression data using unstable RGs greatly affects gene fold change, which means the reliability of the biological conclusions is questionable. Based on the best RGs used, we also found that robo4 is significantly overexpressed in Busulfan-impaired ECs. In conclusion, our data reaffirms the importance of RGs selection for the valid analysis of gene expression in Busulfan-impaired ECs. And it also provides very useful guidance and basis for more accurate differential expression gene screening and future expanding biomolecule study of different drugs such as cyclophosphamide and fludarabine-injured ECs.

show abstract

“…In the characterisation of cell lines, RT-qPCR can be used to investigate cancer stem cell markers, such as expression of clusters of differentiation (CD24, CD44, CD133, and CD166) (Shinji et al, 2019). This method also enables the detection of particular genes needed for cell line characterisation, for example, B2M and RPL29, in the case of tongue carcinoma cell line (Wang et al, 2017). RT-qPCR can be applied for the determination of epithelial-mesenchymal transition (EMT), which contributes to the migration property of cells.…”

Section: Rt-qpcrmentioning

confidence: 99%

From Donor to the Lab: A Fascinating Journey of Primary Cell Lines

Richter

Piwocka

Musielak

et al. 2021

Front. Cell Dev. Biol.

View full text Add to dashboard Cite

Primary cancer cell lines are ex vivo cell cultures originating from resected tissues during biopsies and surgeries. Primary cell cultures are objects of intense research due to their high impact on molecular biology and oncology advancement. Initially, the patient-derived specimen must be subjected to dissociation and isolation. Techniques for tumour dissociation are usually reliant on the organisation of connecting tissue. The most common methods include enzymatic digestion (with collagenase, dispase, and DNase), chemical treatment (with ethylene diamine tetraacetic acid and ethylene glycol tetraacetic acid), or mechanical disaggregation to obtain a uniform cell population. Cells isolated from the tissue specimen are cultured as a monolayer or three-dimensional culture, in the form of multicellular spheroids, scaffold-based cultures (i.e., organoids), or matrix-embedded cultures. Every primary cell line must be characterised to identify its origin, purity, and significant features. The process of characterisation should include different assays utilising specific (extra- and intracellular) markers. The most frequently used approaches comprise immunohistochemistry, immunocytochemistry, western blot, flow cytometry, real-time polymerase chain reaction, karyotyping, confocal microscopy, and next-generation sequencing. The growing body of evidence indicates the validity of the usage of primary cancer cell lines in the formulation of novel anti-cancer treatments and their contribution to drug development.

show abstract

Validation of reference genes for the normalization of RT-qPCR expression studies in human tongue carcinoma cell lines and tissue

Cited by 6 publications

References 24 publications

Dinaciclib, a Bimodal Agent Effective against Endometrial Cancer

Dinaciclib, a Bimodal Agent Effective against Endometrial Cancer

Validation of Housekeeping Genes as Reference for Reverse-Transcription-qPCR Analysis in Busulfan-Injured Microvascular Endothelial Cells

From Donor to the Lab: A Fascinating Journey of Primary Cell Lines

Contact Info

Product

Resources

About