Vacuolar Protein Sorting Receptor in Giardia lamblia

Abstract

In Giardia, lysosome-like peripheral vacuoles (PVs) need to specifically coordinate their endosomal and lysosomal functions to be able to successfully perform endocytosis, protein degradation and protein delivery, but how cargo, ligands and molecular components generate specific routes to the PVs remains poorly understood. Recently, we found that delivering membrane Cathepsin C and the soluble acid phosphatase (AcPh) to the PVs is adaptin (AP1)-dependent. However, the receptor that links AcPh and AP1 was never described. We have studied protein-binding to AcPh by using H6-tagged AcPh, and found that a membrane protein interacted with AcPh. This protein, named GlVps (for Giardia lamblia Vacuolar protein sorting), mainly localized to the ER-nuclear envelope and in some PVs, probably functioning as the sorting receptor for AcPh. The tyrosine-binding motif found in the C-terminal cytoplasmic tail domain of GlVps was essential for its exit from the endoplasmic reticulum and transport to the vacuoles, with this motif being necessary for the interaction with the medium subunit of AP1. Thus, the mechanism by which soluble proteins, such as AcPh, reach the peripheral vacuoles in Giardia appears to be very similar to the mechanism of lysosomal protein-sorting in more evolved eukaryotic cells.

The giardial VPS35 retromer subunit is necessary for multimeric complex assembly and interaction with the vacuolar protein sorting receptor

“…These trophozoites were used as hosts for the expression of transgenic genes and as wild-type controls. The GlVps open reading frames were amplified from genomic DNA using the primers reported [14]. The GlVPS35 was amplified using the 35F (CATTGGATCCATGGCTTTCCAGACCAAAGTAGACC) and 35R (CATT GCATGC GTTTCCGAGGAAGATCTCCATCCTCT) cloned into the tetracycline-inducible vector pINDG-HA modified by introduction of the HA epitope at the C-terminus to generate the p GlVPS-HA vector [26].…”

“…Thus, although Giardia lacks distinct endosomes and lysosomes, it contains peripheral vacuoles (PVs), which perform the role of endosome and lysosome simultaneously [11–13]. We recently showed that soluble hydrolase acid phosphatase (AcPh) is delivered to the PVs by the concerted action of the giardial receptor Vps (GlVps) and adaptor protein 1 (AP-1) [14] but whether GlVps is later recycled to the ER is still unknown.…”

“…The first evidence of retromer-recycling trafficking of GlVps arose from the same work, in which GlVPS35 and GlVps were both precipitated in association with AcPh [14]. However, the interaction between GlVPS35 and GlVps was not tested and remains unknown.…”

Resolving the homology—function relationship through comparative genomics of membrane-trafficking machinery and parasite cell biology

“…AP-1µ also binds the vacuolar receptor Vps, and its knockdown by dsRNA induces degradation of Vps; this is specific to AP-1, as AP-2µ does not bind Vps [51]. Knockdown of AP-1µ also results in mis-localization of two peripheral vacuole proteins [50].…”

Comparative biochemistry of Giardia, Hexamita and Spironucleus: Enigmatic diplomonads

“…Encystation-specific vesicles for the secretion of cyst wall materials constitute a separate class that have been characterized using proteomics. The elaborate glycan-dependent quality-control on unfolded proteins observed in general in eukaryotes is replaced by a novel process in G. intestinalis consisting of the up-regulation of only about 30 genes [36,37]. Specialized endocytotic vesicles, the peripheral vesicles, internalize bulk fluid phase material principally on the dorsal side opposite the attachment disc of the organism.…”