Untitled

Abstract

Six flying fox species, genus Pteropus (four from the Philippines) were investigated using complete cytochrome b gene sequences (1140 bp) to infer their evolutionary relationships. The DNA sequences generated via polymerase chain reaction were analyzed using the neighbor-joining, parsimony, and maximum likelihood methods. We estimated that the first evolutionary event among these Pteropus species occurred approximately 13.90 +/- 1.49 MYA. Within this short period of evolutionary time we further hypothesized that the ancestors of the flying foxes found in the Philippines experienced a subsequent diversification forming two clusters in the topology. The first cluster is composed of P. pumilus (Philippine endemic), P. speciosus (restricted in western Mindanao) with P. scapulatus, while the second one comprised P. vampyrus and P. dasymallus species based on the analysis from first and second codon positions. Consistently, all phylogenetic analyses divulged close association of P. dasymallus with P. vampyrus contradicting the previous report categorizing P. dasymallus under subniger species group with P. pumilus. P. speciosus, and P. hypomelanus. The Philippine endemic species (P. pumilus) is closely linked with P. speciosus. The representative samples of P. vampyrus showed a large genetic distance of 1.87%. The large genetic distance between P. dasymallus and P. hypomelanus, P. pumilus and P. speciosus denotes a distinct species group.

Niemann-Pick C1 Heterogeneity of Bat Cells Controls Filovirus Tropism

“…In the Philippines, RESTV infection was confirmed in bats, monkeys, and pigs ( Barrette et al, 2009 ; Jayme et al, 2015 ; Miranda et al, 1999 ; Miranda and Miranda, 2011 ). Although filovirus infection of this bat species has never been reported, anti-RESTV antibodies were detected in a large flying fox ( Pteropus vampyrus ), which is evolutionary related the to the Yaeyama flying fox ( Bastian et al, 2002 ; Jayme et al, 2015 ). Interestingly, the unique aa motif of loop 1 (i.e., TET found in FBKT1) has also been found in NPC1 of other fruit bat species, including the large flying fox ( P. vampyrus ) and the black flying fox ( Pteropus alecto ) ( Lowe and Eddy, 1997 ), both of which are widely distributed in Asian and Oceanian countries (i.e., P. vampyrus in Brunei Darussalam, China, Indonesia, Malaysia, Myanmar, the Philippines, Singapore, Thailand, Timor-Leste, and Vietnam, and P. alecto in Indonesia and Papua New Guinea) ( Bates et al, 2008 ; Roberts et al, 2018 ).…”

Reproduction and nutritional stress are risk factors for Hendra virus infection in little red flying foxes ( Pteropus scapulatus )

“…Waning immunity would significantly enhance the persistence of HeV in LRFF, conferring on them a critical role in the maintenance of HeV across Pteropus spp. Given that LRFF resolve as the most basal lineage of Pteropus bats (O'Brien 2005), and are genetically distant (Bastian et al 2002;O'Brien 2005), and ecologically and morphologically distinct (Hall & Richards 2000;Birt 2004), from other Australian flying fox species, waning immunity may reflect a more mature host-pathogen relationship in this species.…”

Evolutionary relationships of the old world fruit bats (Chiroptera, Pteropodidae): Another star phylogeny?

“…PCR amplification was carried out using previously published primers ( RAG1 and RAG2 : [9]; vWF : [76]; Cytb : [77]; 12S: [78]; 16S: [16,78]). New primers were designed for the 16S gene: 12l-f (AGAGGAGAYAAGTCGTAMCAAG), 16u-f (AGCCAYCAATTRAGAAAGC), 16q-r (GTTTGCCGAGTTCCTTTTAC), and 16k-r (ATAGATAGAAACCGACCTGGA); and the BRCA1 gene: BRCA1-f2 (AACAGATGGGTTGAAACTAAGG), BRCA1-f3 (AGGYGATTATGTTCAGAAGAAG), BRCA1-r2 (GAAGGCTAGGATTGACAAACTC), and BRCA1-r4 (ATTTAATTCTAGTTCCAYATTGC).…”