UV-Light Exposed Prion Protein Fails to Form Amyloid Fibrils

Abstract

Amyloid fibril formation involves three steps; structural perturbation, nucleation and elongation. We have investigated amyloidogenesis using prion protein as a model system and UV-light as a structural perturbant. We find that UV-exposed prion protein fails to form amyloid fibrils. Interestingly, if provided with pre-formed fibrils as seeds, UV-exposed prion protein formed amyloid fibrils albeit with slightly different morphology. Atomic force microscopy and electron microscopic studies clearly show the formation of fibrils under these conditions. Circular dichroism study shows loss in helicity in UV-exposed protein. UV-exposed prion protein fails to form amyloid fibrils. However, it remains competent for fibril extension, suggesting that UV-exposure results in loss of nucleating capability. This work opens up possibility of segregating nucleation and elongation step of amyloidogenesis, facilitating screening of new drug candidates for specifically inhibiting either of these processes. In addition, the work also highlights the importance of light-induced structural and functional alterations which are important in protein based therapeutics.

Copper Alters Aggregation Behavior of Prion Protein and Induces Novel Interactions between Its N- and C-terminal Regions

“…Cloning, Expression, and Purification of Prion Protein Variants-We have cloned, expressed, and purified mouse PrP(23-231) as described earlier (35). PrP(90 -231) was cloned into pET21a vector after PCR amplification from PrP(23-231)-pET21a template using gene-specific primers (forward primer TGGCATATGGGCCAAGGAGGGGGTAC and reverse primer GCTTTCGAATCAGCTGGATCTTCTCCCG).…”

Molecular Photochemistry

“…For example, UV-light is known to inhibit photosystem II activity in cyanobacterium and to enhance the transcription of particular genes (310nm light) (Vass et al, 2000). It is also known that near UV (290nm) exposed prion protein fails to form amyloid fibrils (Thakur & Rao, 2008). Nucleic acids in living cells are associated with a large variety of proteins.…”