Utilization of biodiesel-derived glycerol or xylose for increased growth and lipid production by indigenous microalgae

Abstract

The use of industrial wastes rich in mineral nutrients and carbon sources to increase the final microalgal biomass and lipid yield at a low cost is an important strategy to make algal biofuel technology viable. Using strains from the microalgal collection of the Université de Montréal, this report shows for the first time that microalgal strains can be grown on xylose, the major carbon source found in wastewater streams from pulp and paper industries, with an increase in growth rate of 2.8 fold in comparison to photoautotrophic growth, reaching up to µ=1.1/day. On glycerol, growth rates reached as high as µ=1.52/day. Lipid productivity increased up to 370% on glycerol and 180% on xylose for the strain LB1H10, showing the suitability of this strain for further development for biofuels production through mixotrophic cultivation.Final Version available online at: http://dx

Microalgal biofuel revisited: An informatics-based analysis of developments to date and future prospects

“…Similarly, the biodiesel-derived co-production (e.g., glycerol or xylose) could also be recycled for increased growth and lipid production. Leite et al [108] reported that some microalgal strains were capable of mixotrophic and heterotrophic growth on biodiesel-derived glycerol and xylose with the significant increase in growth rate and lipid productivity.…”

Morphological characterization, growth appraisal, and probing biofuels potential of newly isolated Scenedesmus sp. from desert Cholistan

“…Polymerase chain reactions (PCRs) were performed in a DNA Engine Peltier thermal cycler PCR (Bio‐Rad) with universal primers 18S rRNA F: 5′‐GTGGTAACGGGTGACGG‐3′ and R: 5′‐GTGCGGCCCAGAACATC‐3′ and Internal transcribed spacer ITS1/ITS4 F: 5′‐TCCGTAGGTGAACCTGCGG‐3ˈand R: 5′‐TCCTCCGCCTTATTGATATCC‐3ˈ for amplification (Leite et al, ). PCR products were purified and successively sequenced at IRIC Genomics Platform (https://genomique.iric.ca) using the Sanger scheme.…”

“…For assessment of preeminent, eco‐friendly, and effective approach, it is prerequisite to expand the efficiency and develop economical approaches of biodiesel production from living organisms, let us say the most favorite one are microalgae (Kishore et al, ; Sajjadi, Chen, Raman, & Ibrahim, ). Friendly nature, higher yields per unit area, growing potentially in a variety of water and/or medium and yield more energy per unit weight related to other energy sources are the prevailing advantages of algae for biodiesel production (Abomohra et al, ; Leite, Paranjape, Abdelaziz, & Hallenbeck, ; Zheng et al, ).…”

“…A normal PT mode of cultivation depends on sunlight energy for the fixation of atmospheric CO 2 into biomass. Nevertheless, this conventional cultivation often suffers from the low algal cell density because of light limitation (Ale et al, ; Leite et al, ; Mirzaie et al, ) and thus low biomass production makes restricted the large‐scale commercial productivity of microalgae (Varfolomeev & Wasserman, ; Zhang et al, ). Consequently, as a feasible alternative approach, researchers have confidence in adopting MT and the HT mode of cultivation that might be a preeminent solution to minimize the economic constrain of microalgae‐based fuel production (Mohan et al, ).…”

“…Hitherto, microalgae were investigated by using different carbon sources (glucose, acetate, food stuff, crops straw hydrolysates, domestic stuff, and cassava starch hydrolysates) as supplement and remarkable results were achieved (Leite et al, ; Song & Pei, ). Similarly, glycerol, a by‐product yield through biodiesel production, was found to perform well by enhancing the biomass, lipid contents, and thus helping in drop biofuel cost (Paranjape, Leite, & Hallenbeck, ; Zhang et al, ).…”