Utility of the SERPINC1 Gene Test in Ischemic Stroke Patients With Antithrombin Deficiency

Kim, Seondeuk; Lee, Woojin; Moon, Jangsup; Jung, Keun‐Hwa

doi:10.3389/fneur.2022.841934

Cited by 2 publications

(2 citation statements)

References 18 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…[6] SERPINC1 genetic testing can also identify the etiology of AT deficiency-related arterial thrombosis in ischemic stroke patients. [14] In addition, genetic testing can also assess the risk of recurrence in patients and make asymptomatic diagnosis of family mutation gene carriers, [15,16] which has important guiding significance for the selection of individualized treatment plans.…”

Section: Discussionmentioning

confidence: 99%

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Hou

Kai-ru

et al. 2022

Medicine

View full text Add to dashboard Cite

Rationale: Inherited antithrombin deficiency (ATD) is a major cause of thrombotic deficiency. Genetic testing is of great value in the diagnosis of hereditary thrombophilia. Herein, we report a case of inherited ATD admitted to our hospital. We include the results of genealogy and discuss the significance of genetic testing in high-risk groups of hereditary thrombophilia.Patient concerns: A 16-year-old male patient presented with chest tightness, shortness of breath, wheezing, and intermittent fever (up to 39 °C) after strenuous exercise for 2 weeks. He also had a cough with white sputum with a small amount of bright red blood in the sputum and occasional back pain.Diagnoses: The blood tests showed that the patient's antithrombin III concentration and activity were both significantly reduced to 41% and 43.2%, respectively. Enhanced chest computed tomography scans showed pulmonary infarction in the lower lobe of the right lung with multiple embolisms in the bilateral pulmonary arteries and branches. Lower vein angiography revealed a contrast-filling defect of the inferior vena cava and left common iliac vein. Thrombosis was considered as a differential diagnosis. His father and his uncle also had a history of thrombosis. The patient was diagnosed with inherited ATD. Further, peripheral venous blood samples of the family members were collected for whole-exome gene sequencing, and Sanger sequencing was used to verify the gene mutation site in the family. The patient and his father had a SERPINC1 gene duplication mutation: c.1315_1345dupCCTTTCCTGGTTTTTAAGAGAAGTTCCTC (NM000488.4).Interventions: An inferior vena cava filter was inserted to avoid thrombus shedding from the lower limbs. Urokinase was injected intermittently through the femoral vein cannula for thrombolysis. Heparin combined with warfarin anticoagulant therapy was sequentially administered. After reaching the international normalized ratio, heparin was discontinued, and oral warfarin anticoagulant therapy was continued. After discharge, the patient was switched to rivaroxaban as oral anticoagulation therapy.Outcomes: The patient's clinical symptoms disappeared. reexamination showed that the thrombotic load was less than before, and the inferior vena cava filter was then removed.Lessons: By this report we highlight that gene detection and phenotypic analysis are important means to study inherited ATD.

show abstract

Section: Discussionmentioning

confidence: 99%

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Hou

Kai-ru

et al. 2022

Medicine

View full text Add to dashboard Cite

show abstract

“…30 In some patients with ischemic stroke, knowledge of IIHBS diagnosis can be a useful prognostic factor. 38…”

Section: Antithrombin Deficiencymentioning

confidence: 99%

Antithrombin Therapy: Current State and Future Outlook

Rodgers,

Mahajerin

2023

Clin Appl Thromb Hemost

View full text Add to dashboard Cite

Antithrombin (AT) is a natural anticoagulant pivotal in inactivating serine protease enzymes in the coagulation cascade, making it a potent inhibitor of blood clot formation. AT also possesses anti-inflammatory properties by influencing anticoagulation and directly interacting with endothelial cells. Hereditary AT deficiency is one of the most severe inherited thrombophilias, with up to 85% lifetime risk of venous thromboembolism. Acquired AT deficiency arises during heparin therapy or states of hypercoagulability like sepsis and premature infancy. Optimization of AT levels in individuals with AT deficiency is an important treatment consideration, particularly during high-risk situations such as surgery, trauma, pregnancy, and postpartum. Here, we integrate the existing evidence surrounding the approved uses of AT therapy, as well as potential additional patient populations where AT therapy has been considered by the medical community, including any available consensus statements and guidelines. We also describe current knowledge regarding cost-effectiveness of AT concentrate in different contexts. Future work should seek to identify specific patient populations for whom targeted AT therapy is likely to provide the strongest clinical benefit.

show abstract

Utility of the SERPINC1 Gene Test in Ischemic Stroke Patients With Antithrombin Deficiency

Cited by 2 publications

References 18 publications

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Inherited antithrombin deficiency caused by a mutation in the SERPINC1 gene: A case report

Antithrombin Therapy: Current State and Future Outlook

Contact Info

Product

Resources

About