Utility of Antigen Detection Test and Polymerase Chain Reaction in the Differentiation of Tuberculous and Non-Tuberculous Mycobacteria

Abstract

Objectives: Cultivation and identification of mycobacteria to species level remains difficult and time-consuming. Hence, easy and rapid diagnostic methods are necessary for the differentiation of Mycobacterium tuberculosis (MTB) from non-tuberculous mycobacteria (NTM). The present study aims to detect and differentiate MTB from NTM isolated from clinical samples by immunochromatographic test (ICT) and polymerase chain reaction (PCR).Methods: Over a period of 1 year, clinical samples (n=496) received from suspected cases of TB, at the Department of Microbiology, Kasturba Medical College Hospital, Mangalore were cultured to isolate Mycobacterium spp. Identification of all the isolates was done by conventional biochemical technique, ICT, and PCR.Results: Among the 496 samples processed, 49 (9.87%) were acid-fast bacilli smear positive and 59 (11.89%) samples showed the growth of Mycobacterium spp. Among these, 10 were rapid growers, 49 were slow-growing mycobacteria, out of which 30 were MTB as identified by conventional biochemical reaction. Out of 59 Mycobacterial isolates subjected to ICT for the detection of MPT 64 antigen, only 28 were identified as MTB. However, all the 30 isolates were correctly identified as MTB by PCR. Conclusion:Hence, PCR is essential for rapid differentiation of non-tuberculous Mycobacterium from MTB. False negative results seen with immunochromatographic MPT 64 antigen assay could be due to mutations within the mpt64 gene. Further studies are necessary to characterize these PCR-positive and immunochromatographic assay negative MTB isolates.

Utility of smear microscopy and GeneXpert for the detection of Mycobacterium tuberculosis in clinical samples

“…Genus Mycobacterium and MTB specific PCR targeting the mycobacterial hsp65 gene was used to confirm the discrepant results of GeneXpert and culture. Duplex PCR was performed on extracted DNA from culture and clinical samples as described by Singh et al 16 The following primer pairs were used: MTB: F5′TGCTCGAGAAGGTCATCGGA3′ and R5′-TCACCTGACCACCGGTGAGA3′, NTM: F5′GAGGTGGCCAAGAAGACGGAC-3′ and R5′-AGCAGCGGCTTGCCCTCTGA3′. Amplicon size of 195 and 515 bp indicated the presence of MTB and NTM, respectively.…”