USP18 recruits USP20 to promote innate antiviral response through deubiquitinating STING/MITA

Abstract

STING (also known as MITA) mediates the innate antiviral signaling and ubiquitination of STING is key to its function. However, the deubiquitination process of STING is unclear. Here we report that USP18 recruits USP20 to deconjugate K48-linked ubiquitination chains from STING and promotes the stability of STING and the expression of type I IFNs and proinflammatory cytokines after DNA virus infection. USP18 deficiency or knockdown of USP20 resulted in enhanced K48-linked ubiquitination and accelerated degradation of STING, and impaired activation of IRF3 and NF-κB as well as induction of downstream genes after infection with DNA virus HSV-1 or transfection of various DNA ligands. In addition, Usp18 mice were more susceptible to HSV-1 infection compared with the wild-type littermates. USP18 did not deubiquitinate STING in vitro but facilitated USP20 to catalyze deubiquitination of STING in a manner independent of the enzymatic activity of USP18. In addition, reconstitution of STING into Usp18 MEFs restored HSV-1-induced expression of downstream genes and cellular antiviral responses. Our findings thus uncover previously uncharacterized roles of USP18 and USP20 in mediating virus-triggered signaling and contribute to the understanding of the complicated regulatory system of the innate antiviral responses.

Regulatory interplay between deubiquitinating enzymes and cytokines

“…However, when USP18 -/-MEF cells with either WT USP18 or DUB activity-mutated USP18 were induced with HSV-1, HCMV or cytosolic DNA, Ifnb, Ifna4, Tnf, IL-6 or Cxcl1 genes increased in expression, indicating that the deubiquitinating activity of USP18 is not responsible for this phenomenon [41]. Subsequently, they searched for DUBs that interact with USP18 and found that knockdown of USP20 inhibited USP18-induced deubiquitination of STING and knockdown of USP18 inhibited USP20-induced deubiquitination of STING [41]. Immunoprecipitation revealed that STING, USP18 and USP20 are arranged as USP20-USP18-STING, but both USP20 and USP18 were associated with the N-terminus of STING [41].…”

“…STING is a transmembrane protein found in mitochondria and endoplasmic reticulum that regulates IFN-promotor activation at the downstream of RIG-I [40]. Zhang et al studied the effect of USP18 (also known as UBP43) on STING and revealed that USP18 interacts with STING to affect IFN-promotor activity [41]. However, when USP18 -/-MEF cells with either WT USP18 or DUB activity-mutated USP18 were induced with HSV-1, HCMV or cytosolic DNA, Ifnb, Ifna4, Tnf, IL-6 or Cxcl1 genes increased in expression, indicating that the deubiquitinating activity of USP18 is not responsible for this phenomenon [41].…”

“…Zhang et al studied the effect of USP18 (also known as UBP43) on STING and revealed that USP18 interacts with STING to affect IFN-promotor activity [41]. However, when USP18 -/-MEF cells with either WT USP18 or DUB activity-mutated USP18 were induced with HSV-1, HCMV or cytosolic DNA, Ifnb, Ifna4, Tnf, IL-6 or Cxcl1 genes increased in expression, indicating that the deubiquitinating activity of USP18 is not responsible for this phenomenon [41]. Subsequently, they searched for DUBs that interact with USP18 and found that knockdown of USP20 inhibited USP18-induced deubiquitination of STING and knockdown of USP18 inhibited USP20-induced deubiquitination of STING [41].…”

“…Subsequently, they searched for DUBs that interact with USP18 and found that knockdown of USP20 inhibited USP18-induced deubiquitination of STING and knockdown of USP18 inhibited USP20-induced deubiquitination of STING [41]. Immunoprecipitation revealed that STING, USP18 and USP20 are arranged as USP20-USP18-STING, but both USP20 and USP18 were associated with the N-terminus of STING [41]. USP20 deubiquitinated K33-or K48-linked ubiquitin of STING [41].…”

USP13 negatively regulates antiviral responses by deubiquitinating STING

“…Poly(I:C), ISD45, DNA90 and HSV120 were previously described36373839. ISD45: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; DNA90: 5′-TACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACATACAGATCTACTAGTGATCTATGACTGATCTGTACATGATCTACA-3′; HSV120: 5′-AGACGGTATATTTTTGCGTTATCACTGTCCCGGATTGGACACGGTCTTGTGGGATAGGCATGCCCAGAAGGCATATTGGGTTAACCCCTTTTTATTTGTGGCGGGTTTTTTGGAGGACTT-3′.…”