Uso de PCR Duplex para detecção dos genes femA e mecA e determinação da concentração inibitória mínima (CIM) em Staphylococcus aureus isolados de leite cru

Teixeira, Junia Pacheco; Silva, Nivaldo da; Fonseca, L. R. C.; Costa, Geraldo Márcio da

doi:10.18241/0073-98552014731615

Cited by 6 publications

(10 citation statements)

References 0 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…All the S. aureus (N = 26) exhibited a 132-base pair amplicon specific species (Figure 2) corresponding to the genetic marker femA. This marker has been described in the literature as a signature sequence for genotyping of S. aureus isolates (Rodrigues da Silva and Silva, 2005;Teixeira et al, 2014;Oliveira et al, 2016), which corroborates the results of the genus and species of microorganisms identified in this study as S. aureus.…”

Section: Resultssupporting

confidence: 89%

“…Genus-level identification of S. aureus strains was performed by tracking the presence of the femA through PCR technique. The pair of primers FemA1-5'AAAAAAGCACATAACAAGCG3' and FemA2-5'GATAAAGAAGAACCAGCAG3' were used and the PCR conditions according to Teixeira et al (2014). The reactions were carried out in a mix containing 1X Taq buffer from the Kappa kit PCR, MgCl 2 (2.5 mM), deoxynucleotides (1 μM), Taq Polymerase Kappa (0.5 U), 1.25 μM of each primer, and 50 ng bacterial DNA in a final total reaction volume of 25 μL.…”

Section: Dna Extraction and Pcr Analysis For The Detection Of The Femmentioning

confidence: 99%

“…Prevention and treatment programs to mastitis include the use of antimicrobials in dairy cattle flocks in an attempt to eliminate the disease (Pellegrino et al, 2011;Silva et al, 2012;Teixeira et al, 2014). However, the indiscriminate use of antibiotics, which can lead to drug multiresistance and the risk of the presence of its residues in the milk, has turned mastitis an important disease to public health (Ganda et al, 2016).…”

Section: Introductionmentioning

confidence: 99%

“…The identification of S. aureus at the species level can be performed by PCR through detection of the femA (factor essential for methicillin resistance) gene. This gene codes for a protein of 48-50 kDa, which is recognized as a specific factor and chromosomally coded in this pathogen, being involved in the structure of the bacterial cell wall (Rodrigues da Silva and Silva, 2005;Teixeira et al, 2014). S. aureus is well known for having resistance to antimicrobial agents, which may lead to complications for the treatment of their infections besides increasing the treatment costs.…”

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Phenotypic and genotypic characterization of Staphylococcus aureus isolates in milk from flocks diagnosed with subclinical mastitis

Xavier¹,

Almeida²,

Souza³

et al. 2017

Genet. Mol. Res.

View full text Add to dashboard Cite

The Staphylococcus aureus is the most common isolated microorganism in ruminant animal species diagnostic with clinical or subclinical mastitis. Dairy herds with these diseases can transfer S. aureus into the milk supply, which can lead to food poisoning in humans. The objective of this study was to evaluate the profile of antimicrobial susceptibility, the presence of femA gene, the genetic relationships among isolates of S. aureus obtained from milk originating from flocks diagnosed with subclinical mastitis in nine rural properties in the northern of Minas Gerais State. To this end, 498 samples of bovine milk tested positive for the California mastitis test (CMT) were subjected to morphological methods and biochemical patterns for microbiological presumptive identification of S. aureus. The PCR test with the genetic marker femA was used to confirm the species S. aureus. All the 26 isolates presumptively identified as S. aureus amplified a fragment of 132 bp corresponding to the femA gene. The profile of antimicrobial susceptibility was performed according to the disk-diffusion methodology and two isolates were susceptible to all the antibiotics tested. The drug multiresistence was found in 80.76% of the isolates. The determination of the genetic profile and the clonal relationship among the isolates was performed by the method of DNA RAPD-PCR polymorphism. The S. aureus isolates were divided into two groups with 26 distinct subgroups. The analysis of RAPD-PCR showed no genetic diversity among them, heterogeneous profile and absence of clonality.

show abstract

Section: Resultssupporting

confidence: 89%

Section: Dna Extraction and Pcr Analysis For The Detection Of The Femmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 2 more Smart Citations

Phenotypic and genotypic characterization of Staphylococcus aureus isolates in milk from flocks diagnosed with subclinical mastitis

Xavier¹,

Almeida²,

Souza³

et al. 2017

Genet. Mol. Res.

View full text Add to dashboard Cite

show abstract

“…Additionally, the presence of the femA gene was screened by the PCR technique. The primers FemA1-5′ AAAAAAGCACATAACAAGCG 3′ and FemA2-5′ GATAAAGAAGAACCAGCAG 3′ were used and PCR conditions were according to Teixeira et al. (2014).…”

Section: Methodsmentioning

confidence: 99%

Extract of Mangifera indica L. leaves may reduce biofilms of Staphylococcus spp. in stainless steel and teatcup rubbers

Manzur

Valdo

Morais-Costa

et al. 2019

Food sci. technol. int.

View full text Add to dashboard Cite

Human ingestion of antimicrobial residues in dairy products is a problem of public health. In this study we evaluated antibacterial effectiveness of aqueous and ethanolic leaf extracts of Mangifera indica L. as a natural alternative for reduction of Staphylococcus spp. biofilms. Eight Staphylococcus spp. strains from cows with mastitis and the Staphylococcus aureus strain (ATCC 25923) were evaluated. High performance liquid chromatography indicated the presence of phenolic compounds in the aqueous extract. Agilent Technologies gas chromatography revealed the presence of phenolic compounds, carbohydrates, and gallic acid in ethanolic extract. The tannin contents were 2.27 ± 0.01 and 2.67 ± 0.01% for ethanolic extract and aqueous extract, respectively. Extracts were evaluated in agar diffusion test and the size of inhibition zones were compared. The ethanolic extract was the most effective, showing minimum inhibitory concentrations and minimum bactericidal concentrations between 1.8–7.5 and 15.1–45.3 mg/ml, respectively. After tannin removal, the extracts were less effective, indicating these secondary metabolites as one of the main antibacterial compounds. The ethanolic extract at 45.3 mg/ml reduced mature biofilms in teat rubber (average: 3.91 log reduction) and stainless steel (average: 3.87 log reduction) after 5 min of contact. The extracts of M. indica leaves represent natural alternatives against Staphylococcus spp. strains and the ethanolic extract shows potential as a natural sanitizer.

show abstract

Molecular Typing with BOX-PCR of Staphylococcus aureus Isolated from Milk Samples

Mutlu

Arslan

2021

Bitlis Eren Üniversitesi Fen Bilimleri Dergisi

View full text Add to dashboard Cite

The aim of this study is to characterize 98 Staphylococcus aureus isolated from bovine subclinical mastitis in Konya region with BOX primer. A total of 28 band profiles ranging from ~ 950-300 bp were generated by the BOX primer. This band profile was evaluated according to Nei homology and a dendogram (UPGMA) was obtained. According to the data obtained, 95 isolates with genetic similarity varying between 50-100% were in the same group. This study demonstrates that the BOX-PCR technique provides a fast and reliable tool to investigate epidemiology in S. aureus.

show abstract

Uso de PCR Duplex para detecção dos genes femA e mecA e determinação da concentração inibitória mínima (CIM) em Staphylococcus aureus isolados de leite cru

Cited by 6 publications

References 0 publications

Phenotypic and genotypic characterization of Staphylococcus aureus isolates in milk from flocks diagnosed with subclinical mastitis

Phenotypic and genotypic characterization of Staphylococcus aureus isolates in milk from flocks diagnosed with subclinical mastitis

Extract of Mangifera indica L. leaves may reduce biofilms of Staphylococcus spp. in stainless steel and teatcup rubbers

Molecular Typing with BOX-PCR of Staphylococcus aureus Isolated from Milk Samples

Contact Info

Product

Resources

About