Use of psoralen-coupled nucleotide primers for screening of COL4A5 mutations in Alport syndrome

Meta-analysis of genotype-phenotype correlation in X-linked Alport syndrome: impact on clinical counselling

“…Positions of primers for each exon are shown in Table 1. Primers marked 'Ps' contained a psoralen derivative for photo crosslinking prior denaturing gradient gel electrophoresis (DGGE) analysis [48]. PCR products were purified through filter columns (Mobitech, Gö ttingen, Germany) and sequenced on an ABI sequencer 373 using the PRISM dye deoxy terminator cycle sequencing kit.…”

“…For screening by DGGE, samples of two separate patients were mixed at 958C, cooled down to 558C, photo-crosslinked and loaded on a 6.8% polyacrylamide gel containing a linear gradient of denaturants (100% being equivalent to 40% formamide and 7 M urea) [48]. The gel was run in 1 3 TAE buffer (Tris 40 mM, EDTA 1 mM, pH 8.0) at 120 Vuh at a temperature of 608C.…”

Sporadic case of X-chromosomal Alport syndrome in a consanguineous family

“…Primers were selected according to the published sequence of the COL4A5 gene [16]. Primer 45A-Ps (Ps-AA-GGCTTCCATTTCT-TGTAACC) containing a psoralen derivative at its 5' end for photo crosslinking [27] and R45B (CTGTACATTCTGCACATGTATC) were used to amplify COL4A5 exon 45.…”

“…DGGE was essentially performed as described previously [27]. For exon 45, a gradient of 10%-35% denaturing agent along the direction of electrophoresis was used [28].…”

Mild Forms of Alport Syndrome: Hereditary Nephropathy in the Absence of Extra-Renal Features

“…In general, substitution and missense mutations in the NC1 domain, as in other regions of COL4A5, lead to hematuria, proteinuria, ESRF and sensorineural hearing loss with an overwhelming predominance in males (Barker et al, 1996, Barker et al, 1997, Gross et al, 2002, Hertz et al, 2001, Inoue et al, 1999, Knebelmann et al, 1996, Nakanishi et al, 1994, Netzer et al, 1996, Zhou et al, 1991. A previous study classified X-linked Alport syndrome patients caused by mutations involving the NC1 domain into Type S (severe) phenotype (Gross et al, 2002).…”