Use of multiple 16S rRNA-targeted fluorescent probes to increase signal strength and measure cellular RNA from natural planktonic bacteria

Abstract

Fluorescent oligonucleotide probes can be used to identify bacterial cells by hybridizing to specific rRNA sequences that are unique to a taxon. It has been suggested that single-cell RNA content could be estimated from the resulhng cell fluorescence, which is directly proportional to rRNA content However, this possibility was never assessed quantitatively for use in field studies, where most natural bacteria, due to their small size and slow growth, do not have enough rRNA to yield sufficient fluorescence for detection. One approach for increasing the fluorescence per rRNA molecule IS the use of multiple probes targeted to independent sites in the rRNA molecule. In this study, we hybridized n~ultiple probes (3 universal and 4 bacterial) to cultured marine bacterial isolates, and to natural bacterial assemblages from coastal water. For S of the 7 probes (2 probes did not hybridize to some of the isolates), cell fluorescence increased linearly with the number of probes hybridized. The natural bacterial assemblages showed an asymptotic increase of the probe-labeled fraction from ca 20% (1 probe) to 75% (5 probes) of the total population. The estimated detection limit was 0.3 fg RNA cell-' with S probes. RNA contents estimated from the fluorescence of probe-labeled cells agreed well to those determined separately by ethidium bromide fluorometry (differed by average 16 %, n = 3). Calibration of the photometer against fluorescence standards was critical for accurate measurements and comparisons.

Tracking heavy water (D 2 O) incorporation for identifying and sorting active microbial cells

“…Finally, MDA products were diluted 50-fold in sterile nuclease-free water. Bacterial 16S rRNA genes were amplified with primers 341F (5′-CCTACGGGNGGCWGCAG-3′) and 785R (5′-GACTACHVGG-GTATCTAATCC-3′) (105,106 , and a clone library was produced using the TOPO TA cloning kit (Invitrogen) according to the manufacturer's instructions. Fortyeight clones were picked from each clone library and were sent to a company (Microsynth) for Sanger sequencing.…”

Improved group-specific PCR primers for denaturing gradient gel electrophoresis analysis of the genetic diversity of complex microbial communities

“…a Nucleotide sequences of the primers, which have been published previously, and the GC clamp are: 341f, CCTACGGGAGGCAGCAG (Muyzer et al, 1993); 518f, CCAGCAGCCGCGGTAAT (Muyzer et al, 1993); 518r, ATTACCGCGGCTGCTGG (Muyzer et al, 1993); 785r, CTACCAGGG TATCTAATCC (Lee et al, 1993); 907r, CCGTCAATTCMTTTGAGTTT (Muyzer et al, 1998); GC clamp, CGCCCGCCGCGCGCGGCGGG CGGGGCGGGGGCACGGGGGG (Muyzer et al, 1993); Please note, the sequence of the bacterial primer 785r (E. coli position 785-803) matches 81.2% of all 16S rRNA gene sequences in the ROSE database, but only 1% of the Cyanobacteria/chloroplast 16S rRNA gene sequences. b 100% denaturant contains 7 M urea and 40% (v/v) formamide.…”

Single‐cell RNA content of natural marine planktonic bacteria measured by hybridization with multiple 16S rRNA‐targeted fluorescent probes

“…Two options are currently available to increase fluorescence signals from rRNA-poor bacteria. One is the simultaneous use of multiple probes that are designed to hybridize to independent target sites in the rRNA molecule (multiple-probe method; Amann et al 1990a;Lee et al 1993). The other is a probe to which multiple fluorochromes (multiple-fluorochrome method) or any reporter molecules are indirectly attached (Amann et al 1992;Zarda et al 199 1;DeLong unpubl.…”