Use of chemical clamps in denaturing gradient gel electrophoresis: application in the detection of the most frequent Mediterranean beta-thalassemic mutations.

Abstract

'To whom reprint requestdcorrespondence should be addressed.Aniridia is an autosomal dominant panocular disorder, characterized by hypoplasia of the iris. It is caused by mutations in the PAX6 gene. This gene encodes a 422-amino acid transcription factor. This protein includes paired and homeo domains, which bind DNA and a proline-serine and threonine-rich PST domain. Here we report an 8-bp duplication mutation (853ins8) in exon 10 within the PST domain of PAX6 in an aniridia patient. Instead of ACCTAGTCATATTCCT found in the normal PAX6 sequence, we found ACCTAGTCATATAGTCATAlTCCT in the mutant DNA. It disrupts codon 285 and causes a translational hameshift leading to a stop codon downstream. This results in the truncation of the C-terminal of PAX6 within the F' ST domain. Only four mutations were described so far in the PST domain of PAX6 in aniridia patients. They all leave the known DNA binding region intact, but truncate the protein and remove part of the PST-rich region. Recently, it was demonstrated (Glaser et al., 1994) that the PST domain is a strong transcriptional activator in vitro.It stimulates the expression of a reporter gene when fused to the DNA-binding domain of the yeast GAL4 gene sequence (Glaser et al., 1994).If PAX6 is truncated within the PST domain, it may lack in vivo the transcriptional activiry of the PST domain. This would be sufficient to cause the aniridia phenotype. ACKNOWLEDGMENTS

Dynamics of Bacterial Community Composition and Activity during a Mesocosm Diatom Bloom

“…DGGE profiles of reamplified, cloned DNA were used to check for heteroduplexes (13) and to confirm the positions of cloned bands relative to the original sample as described previously (57).…”

Oligophrenin-1 encodes a rhoGAP protein involved in X-linked mental retardation

“…In each amplification, one primer was a 5Ј psoralen-modified primer 17 . PCR products were checked on agarose gels before DGGE analysis and direct sequencing.…”

Overexpression of vasopressin (V3) and corticotrophin‐releasing hormone receptor genes in corticotroph tumours

“…Search for mutations within the coding region of the human V3 receptor was performed by DDGE as described, using Psoralen (Pso) as chemical clamps (Fernandez et al, 1993). According to computer analysis the coding region was divided into 4 domains, amplified using the following oligonucleotides: fragment 1 TGGGATGCCAACCCCACCCCTC and Pso-AGGTAGCGGTCCAGCGTCAT, fragment 2: Pso-ATGACGCTGGACCGCTACCTG and TTTTACAGATCTC GTGGC, fragment 3: CCACGAGATCTGTAAAAAC and Pso-ACCCCAGCAAGCGATGATGGG and fragment 4: GGGTCAG CAGCATCAACAGC and Pso-ACCCCCACAGCAGGCAA GGTG.…”