Urotensin-II Receptor Stimulation of Cardiac L-type Ca2+ Channels Requires the βγ Subunits of Gi/o-protein and Phosphatidylinositol 3-Kinase-dependent Protein Kinase C β1 Isoform

Zhang, Yuan; Ying, Jiaoqian; Jiang, Dongsheng; Chang, Zhigang; Li, Hua; Zhang, Guoqiang; Gong, Shan Shan; Jiang, Xinghong; Tao, Jin

doi:10.1074/jbc.m114.615021

Cited by 24 publications

(26 citation statements)

References 69 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although others suggest that calcium is vital to the chemerin signaling of immune cells [27, 31], hematopoietic [32] and mesenchymal stem cells [33], we are the first to link chemerin to the smooth muscle cell and to the L-type voltage gated calcium channel in any system. In both rat myocytes and vascular smooth muscle cells, L-type calcium channels have been linked to G i -protein mechanisms [34, 35], lending support to the finding that extracellular calcium is essential to chemerin-induced vasoconstriction.…”

Section: Discussionmentioning

confidence: 90%

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Ferland

Darios

Neubig

et al. 2017

Vascular Pharmacology

View full text Add to dashboard Cite

Chemerin is an adipokine associated with increased blood pressure, and may link obesity with hypertension. We tested the hypothesis that chemerin-induced contraction of the vasculature occurs via calcium flux in smooth muscle cells. Isometric contraction of rat aortic rings was performed in parallel with calcium kinetics of rat aortic smooth muscle cells to assess the possible signaling pathway. Chemerin-9 (nonapeptide of the chemerin S157 isoform) caused a concentration-dependent contraction of isolated aorta (EC50 100 nM) and elicited a concentration-dependent intracellular calcium response (EC50 10 nM). Pertussis toxin (Gi inhibitor), verapamil (L-type Ca2+ channel inhibitor), PP1 (Src inhibitor), and Y27632 (Rho kinase inhibitor) reduced both calcium influx and isometric contraction to chemerin-9 but PD098059 (Erk MAPK inhibitor) and U73122 (PLC inhibitor) had little to no effect on either measure of chemerin signaling. Although our primary aim was to examine chemerin signaling, we also highlight differences in the mechanisms of chemerin-9 and recombinant chemerin S157. These data support a chemerin-induced contractile mechanism in vascular smooth muscle that functions through Gi proteins to activate L-type Ca2+ channels, Src, and Rho kinase. There is mounting evidence linking chemerin to hypertension and this mechanism brings us closer to targeting chemerin as a form of therapy.

show abstract

Section: Discussionmentioning

confidence: 90%

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Ferland

Darios

Neubig

et al. 2017

Vascular Pharmacology

View full text Add to dashboard Cite

show abstract

“…MT 2 receptors in a variety of primary cells and tissues are known to act via both PTX‐sensitive and ‐insensitive G‐proteins . Distinct from that for G i , which inhibits adenylyl cyclase, G o mediates its effects through the actions of a common pool of G βγ dimers . In mouse TG neurons, we have found that the G βγ of G o is involved in the MT 2 receptor‐mediated T‐type channel inhibition based upon: (i) preincubation of cells with PTX prevented the melatonin‐induced response, which indicates G i/o ‐mediated mechanisms; (ii) coimmunoprecipitation indicated that the MT 2 receptor interacts directly with G o , but not G I ; (iii) shRNA‐mediated knockdown of G o completely abolished the melatonin‐induced T‐type channel response; and (iv) intracellular application of QEHA peptide abolished the melatonin‐induced effect.…”

Section: Discussionmentioning

confidence: 91%

“…Immunoblotting was conducted as described in our previous reports . Briefly, mouse TGs were quickly dissected and homogenized in ice‐cold lysis buffer.…”

Section: Methodsmentioning

confidence: 99%

“…Recombinant adenoviral shuttle vector pAdtrack‐CMV‐GFP carrying PKC η short hairpin RNA (shRNA) (Ad‐PKC η ‐shRNA) or G o ‐shRNA (Ad‐G o ‐shRNA) was constructed by GeneChem Co., Ltd. (Shanghai, China). Adenovirus‐mediated silencing was performed as described previously . The sequences of the shRNAs for PKC η and Gα o were designed based on GenBank accession numbers and , respectively and the optimal shRNA sequence for knockdown (PKC η : 5′‐GGATGCCAAGATTGCAGAACA‐ 3′; Gα o : 5′‐CCAAAGACGTGA AATTACTCCTGCT‐3′) was selected.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Melatonin‐mediated inhibition of Cav3.2 T‐type Ca²⁺ channels induces sensory neuronal hypoexcitability through the novel protein kinase C‐eta isoform

Zhang

Wang

et al. 2018

Journal of Pineal Research

Self Cite

View full text Add to dashboard Cite

Recent studies implicate melatonin in the antinociceptive activity of sensory neurons. However, the underlying mechanisms are still largely unknown. Here, we identify a critical role of melatonin in functionally regulating Cav3.2 T-type Ca channels (T-type channel) in trigeminal ganglion (TG) neurons. Melatonin inhibited T-type channels in small TG neurons via the melatonin receptor 2 (MT receptor) and a pertussis toxin-sensitive G-protein pathway. Immunoprecipitation analyses revealed that the intracellular subunit of the MT receptor coprecipitated with Gα . Both shRNA-mediated knockdown of Gα and intracellular application of QEHA peptide abolished the inhibitory effects of melatonin. Protein kinase C (PKC) antagonists abolished the melatonin-induced T-type channel response, whereas inhibition of conventional PKC isoforms elicited no effect. Furthermore, application of melatonin increased membrane abundance of PKC-eta (PKC ) while antagonism of PKC or shRNA targeting PKC prevented the melatonin-mediated effects. In a heterologous expression system, activation of MT receptor strongly inhibited Cav3.2 T-type channel currents but had no effect on Cav3.1 and Cav3.3 current amplitudes. The selective Cav3.2 response was PKC dependent and was accompanied by a negative shift in the steady-state inactivation curve. Furthermore, melatonin decreased the action potential firing rate of small TG neurons and attenuated the mechanical hypersensitivity in a mouse model of complete Freund's adjuvant-induced inflammatory pain. These actions were inhibited by T-type channel blockade. Together, our results demonstrated that melatonin inhibits Cav3.2 T-type channel activity through the MT receptor coupled to novel G -mediated PKC signaling, subsequently decreasing the membrane excitability of TG neurons and pain hypersensitivity in mice.

show abstract

“…It has been shown that UII applied in the absence of extracellular Ca 2+ induces transient cytosolic Ca 2+ release from the sarcoplasmic reticulum (SR) (18). Recent studies have demonstrated that UII-induced cardiomyocyte hypertrophy is associated with the changes in the intracellular Ca 2+ concentration (19). However, the precise signaling mechanisms responsible for UII-induced cardiac hypertrophy remain to be elucidated.…”

Section: Introductionmentioning

confidence: 99%

Role of PKA in the process of neonatal cardiomyocyte hypertrophy induced by urotensin II

Xu¹,

Han²,

Shi³

et al. 2017

International Journal of Molecular Medicine

View full text Add to dashboard Cite

The model of urotensin II (UII)-induced cardiomyocyte hypertrophy has been widely used in studies on hypertrophy. However, the molecular mechanisms responsible for UII-induced cardiomyocyte hypertrophy have not yet been fully elucidated. It has been demonstrated that cardiomyocyte hypertrophy induced by UII is associated with changes in the intracellular Ca2+ concentration. In the present study, we investigated whether the cAMP-dependent protein kinase A (PKA)‑mediated upregulation of the phosphorylation levels of phospholamban (PLN) at Ser16 contributes to UII-induced cardiomyocyte hypertrophy. After primary cultures of neonatal rat cardiomyocytes were exposed to UII for 48 h, cell size, protein/DNA contents and intracellular Ca2+ levels were detected. Western blot analysis was used to quantify the phosphorylated and total forms of PKA, PLN and the total amount of sarco/endoplasmic reticulum Ca2+-ATPase (SERCA)2a. UII increased the cell size, the protein/DNA ratio and the intracellular Ca2+ levels, consistent with the characteristics of hypertrophic response. In addition, exposure to UII upregulated the phosphorylation levels of PKA, and the expression levels of its downstream proteins, PLN and SERCA2a. However, treatment with PKA inhibitor (KT-5720) reversed all these effects of UII. On the whole, our results suggest that UII induces cardiomyocyte hypertrophy through the PKA-mediated upregulation of PLN phosphorylation at Ser16, which provides a new experimental foundation for the prevention and/or treatment of cardiac hypertrophy.

show abstract

Urotensin-II Receptor Stimulation of Cardiac L-type Ca2+ Channels Requires the βγ Subunits of Gi/o-protein and Phosphatidylinositol 3-Kinase-dependent Protein Kinase C β1 Isoform

Cited by 24 publications

References 69 publications

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Melatonin‐mediated inhibition of Cav3.2 T‐type Ca²⁺ channels induces sensory neuronal hypoexcitability through the novel protein kinase C‐eta isoform

Role of PKA in the process of neonatal cardiomyocyte hypertrophy induced by urotensin II

Contact Info

Product

Resources

About

Urotensin-II Receptor Stimulation of Cardiac L-type Ca2+ Channels Requires the βγ Subunits of Gi/o-protein and Phosphatidylinositol 3-Kinase-dependent Protein Kinase C β1 Isoform

Cited by 24 publications

References 69 publications

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Chemerin-induced arterial contraction is Gi- and calcium-dependent

Melatonin‐mediated inhibition of Cav3.2 T‐type Ca2+ channels induces sensory neuronal hypoexcitability through the novel protein kinase C‐eta isoform

Role of PKA in the process of neonatal cardiomyocyte hypertrophy induced by urotensin II

Contact Info

Product

Resources

About

Melatonin‐mediated inhibition of Cav3.2 T‐type Ca²⁺ channels induces sensory neuronal hypoexcitability through the novel protein kinase C‐eta isoform