Urease Expression in Pathogenic Yersinia enterocolitica Strains of Bio-Serotypes 2/O:9 and 1B/O:8 Is Differentially Regulated by the OmpR Regulator

Abstract

Yersinia enterocolitica exhibits a dual lifestyle, existing as both a saprophyte and a pathogen colonizing different niches within a host organism. OmpR has been recognized as a regulator that controls the expression of genes involved in many different cellular processes and the virulence of pathogenic bacteria. Here, we have examined the influence of OmpR and varying temperature (26 • C vs. 37 • C) on the cytoplasmic proteome of Y. enterocolitica Ye9N (bio-serotype 2/O:9, low pathogenicity). Differential label-free quantitative proteomic analysis indicated that OmpR affects the cellular abundance of a number of proteins including subunits of urease, an enzyme that plays a significant role in acid tolerance and the pathogenicity of Y. enterocolitica. The impact of OmpR on the expression of urease under different growth conditions was studied in more detail by comparing urease activity and the transcription of ure genes in Y. enterocolitica strains Ye9N and Ye8N (highly pathogenic bio-serotype 1B/O:8). Urease expression was higher in strain Ye9N than in Ye8N and in cells grown at 26 • C compared to 37 • C. However, low pH, high osmolarity and the presence of urea did not have a clear effect on urease expression in either strain. Further analysis showed that OmpR participates in the positive regulation of three transcriptional units encoding the multi-subunit urease (ureABC, ureEF, and ureGD) in strain Ye9N, but this was not the case in strain Ye8N. Binding of OmpR to the ureABC and ureEF promoter regions was confirmed using an electrophoretic mobility shift assay, suggesting that this factor plays a direct role in regulating the transcription of these operons. In addition, we determined that OmpR modulates the expression of a ureR-like gene encoding a putative regulator of the ure gene cluster, but in the opposite manner, i.e., positively in Ye9N and negatively in Ye8N. These findings provide some novel insights into the function of OmpR in adaptation strategies of Y. enterocolitica.

The Regulator OmpR in Yersinia enterocolitica Participates in Iron Homeostasis by Modulating Fur Level and Affecting the Expression of Genes Involved in Iron Uptake

“…OmpR has been identified as a transcriptional regulator of various genes involved in the control of diverse cellular processes and functions in bacteria including Y. enterocolitica [ 58 , 68 , 75 , 87 , 88 ]. Based on the results of proteomic analyses, the production of a number of membrane proteins involved in the uptake and transport of compounds into Y. enterocolitica cells, including several that participate in iron or heme acquisition, is subject to control by the regulator OmpR [ 80 ].…”

Transcriptional factor OmpR positively regulates prodigiosin biosynthesis in Serratia marcescens FZSF02 by binding with the promoter of the prodigiosin cluster

“…The binding region of the OmpR was identified as 5′CATTTATTTACATTTAC3′ (Figure 3) by a DNase I footprinting assay. The binding sequence showed 45% identity to the E. coli consensus sequence (5′TTTTACTT TTGTAACATAT3′; Maeda et al, 1991) and 55% identity to that of Y. enterocolitica (5′ATTTATTGATGGTAACAATT3′; Nieckarz et al, 2020). Many two-component systems regulating proteins can autoregulate their own expression by binding to their promoters, and this kind of feedback allows the regulatory functions of the system to be more flexible (Groisman, 2016).…”

Association between Gut Microbiota Dysbiosis and the CHA2DS2-VASc Score in Atrial Fibrillation Patients

“…Previous research studies reported that urease as a virulence factor of various pathogenic bacteria is related to the progress of several long-lasting diseases, including colitis, atherosclerosis, and rheumatoid arthritis [ 33 , 35 ]. Similarly, assimilatory ferredoxin-dependent nitrate reductase (nirA) is essential for the full virulence of various bacteria [ 36 , 37 ]. In the light of our results, three distinct subunits with alpha, beta, and gamma (as a crucial structural component of urease [ 35 , 36 ]) and nirA were enriched in AF patients with high thromboembolic risk.…”

“…Similarly, assimilatory ferredoxin-dependent nitrate reductase (nirA) is essential for the full virulence of various bacteria [ 36 , 37 ]. In the light of our results, three distinct subunits with alpha, beta, and gamma (as a crucial structural component of urease [ 35 , 36 ]) and nirA were enriched in AF patients with high thromboembolic risk. Several studies demonstrated that 4-methylcatechol, a flavonoid metabolite formed by GM, with potent vasorelaxant, anti-inflammatory, antidiabetic, and antiplatelet effects, reduces endothelial dysfunction [ 38 , 39 ].…”