Upstream stimulatory factor 2 is implicated in the progression of biliary atresia by regulation of hepcidin expression

Huang, Ying‐Hsien; Huang, Chao‐Cheng; Chuang, Jiin‐Haur; Hsieh, Chie-Sung; Lee, Shin-Ye; Chen, Chao‐Long

doi:10.1016/j.jpedsurg.2008.03.037

Cited by 13 publications

(8 citation statements)

References 31 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Although no proof has been obtained so far whether posttranslational modification events or just specific occurrence of these interactors regulate USF function, they may contribute to different cellular localization of USFs, in particular USF2. Since nuclear translocation of USF2 seems to be a tool for its regulation ( Frenkel et al, 1998 ; Huang et al, 2008 ), the involvement of interacting factors in this process was proposed in experiments showing that USF2 was expressed and properly localized in the nucleus of Saos-2 cells, although USF2 was completely inactive in these cells ( Qyang et al, 1999 ). Another study suggested the involvement of cofactors in the regulation of USF2 since it was polyubiquitinated and subsequently degraded by the proteasome in response to hypoxia ( Jiang and Mendelson, 2005 ).…”

Section: Involvement Of Co-factors In the Regulation Of Usf Activitymentioning

confidence: 99%

Protein kinases as switches for the function of upstream stimulatory factors: implications for tissue injury and cancer

et al. 2015

View full text Add to dashboard Cite

The upstream stimulatory factors (USFs) are regulators of important cellular processes. Both USF1 and USF2 are supposed to have major roles in metabolism, tissue protection and tumor development. However, the knowledge about the mechanisms that control the function of USFs, in particular in tissue protection and cancer, is limited. Phosphorylation is a versatile tool to regulate protein functions. Thereby, phosphorylation can positively or negatively affect different aspects of transcription factor function including protein stability, protein–protein interaction, cellular localization, or DNA binding. The present review aims to summarize the current knowledge about the regulation of USFs by direct phosphorylation and the consequences for USF functions in tissue protection and cancer.

show abstract

Section: Involvement Of Co-factors In the Regulation Of Usf Activitymentioning

confidence: 99%

Protein kinases as switches for the function of upstream stimulatory factors: implications for tissue injury and cancer

et al. 2015

View full text Add to dashboard Cite

show abstract

“…In the present study, we evaluated the replication results of USF2 rs916145 polymorphism in a larger case-control population with 506 cases and 1473 controls, compared with the same study conducted by Huang et al [23] in 2008, which demonstrated that C allele and CC allele of rs916145 in USF2 gene had more frequency for developing BA in 52 BA patients and 96 healthy controls. However, in our study, we found that the rs916145 genotype (CC, GC, GG) had the similar frequency in 506 BA patients (11.93, 50.00, 38.07%) and 1473 normal controls (14.16, 47.01, 38.83%), giving limited association between rs916145 polymorphism and risk of BA.…”

Section: Discussionmentioning

confidence: 95%

“…Shibata et al [22] reported that the SNPs of USF2 gene did not show significant association with onset of Alzheimer's disease (AD). However, another study carried out in 52 patients of BA and 96 healthy controls for USF2 gene SNPs (rs7251432 and rs916145) showed that C allele of rs916145 in USF2 gene had more frequency for developing BA [23].…”

Section: Introductionmentioning

confidence: 90%

“…Then, a UV spectrophotometer (NanoDrop Technologies, Wilmington, DE) was used to determine DNA concentration and purity by measuring spectrophotometer absorbance at 260 and 280 nm. The SNP rs916145 of USF2 gene was selected from the previous study conducted by Huang et al [23] and successfully designed using the MassAR-RAY iPLEX Gold System (Sequenom). The TaqMan™ SNP Genotyping Assay of USF2 rs916145 whose context sequence is 'GTAAGCTTGCTCTGGAGAGGATGTA[C/G]CTGCAGCCGGCGCCCAGCTCTCGAG' was bought from Thermo Fisher (catalog# 4351379, Applied Biosystems™).…”

Section: Polymorphism Analysismentioning

confidence: 99%

See 1 more Smart Citation

Irrelevance of USF2 rs916145 polymorphism with the risk of biliary atresia susceptibility in Southern Chinese children

Chen

Tan

et al. 2020

Bioscience Reports

View full text Add to dashboard Cite

Backgrounds: Biliary atresia (BA) is a very rare neonatal disease, however, it has been the most common cause of obstructive jaundice in infancy. The complex pathogenesis of BA is not entirely clear and a lot of possible pathogenic mechanisms have been proposed to explain the etiology of BA, including genetic, inflammatory, environmental and developmental abnormalities. As a transcription factor, USF2 gene rs916145 polymorphism has been shown to be related to the risk of BA. Methods: We examined the USF2 rs916145 genotype in a large case–control study consisting of 506 BA patients and 1473 healthy controls, using the MassARRAY iPLEX Gold system (Sequenom). Odds ratios (ORs) and 95% confidence intervals (CIs) were used to evaluate the association between the USF2 gene rs916145 polymorphism and BA susceptibility. Results: The frequency of different genotypes showed no statistical significance (GG/GC, OR: 1.09, P=0.470, 95% CI: 0.87–1.35; GG/CC, OR: 0.86, P=0.378, 95% CI: 0.62–1.20). No obvious association was revealed between the USF2 gene rs916145 polymorphism and BA susceptibility. Conclusion: USF2 rs916145 polymorphism may not be the best predictor of BA.

show abstract

“…ly), could determine phenotypic variation in hepcidin expression between individuals. For example, Huang et al 21 found an association between biliary atresia and a polymorphism in USF2 that decreased hepcidin expression by this transcription factor.…”

Section: Trans-acting Regulatory Variation In Hepcidin Expressionmentioning

confidence: 99%

Genetic variation in hepcidin expression and its implications for phenotypic differences in iron metabolism

Bayele¹,

Srai²

2009

Haematologica

View full text Add to dashboard Cite

Upstream stimulatory factor 2 is implicated in the progression of biliary atresia by regulation of hepcidin expression

Cited by 13 publications

References 31 publications

Protein kinases as switches for the function of upstream stimulatory factors: implications for tissue injury and cancer

Protein kinases as switches for the function of upstream stimulatory factors: implications for tissue injury and cancer

Irrelevance of USF2 rs916145 polymorphism with the risk of biliary atresia susceptibility in Southern Chinese children

Genetic variation in hepcidin expression and its implications for phenotypic differences in iron metabolism

Contact Info

Product

Resources

About