Upregulation of Slug expression by cyclosporine A contributes to the pathogenesis of gingival overgrowth

Tsai, Cheng-Han; Yu, Cheng–Chia; Lee, Shiuan-Shinn; Yu, Hui-Chieh; Huang, Fu‐Mei; Chang, Yu‐Chao

doi:10.1016/j.jfma.2016.04.001

Cited by 11 publications

(9 citation statements)

References 25 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Researchers have shown that EMT can promote and maintain stemness properties of stem cells 19 . Recently, we reported that the upregulation of Snail 10 and Slug 11 may play an important role in the pathogenesis of CsA-induced gingival overgrowth. Thus, the detailed molecular mechanisms involved in the regulatory links between Nanog and EMT properties are worthy of further investigation.…”

Section: Discussionmentioning

confidence: 95%

“…Total RNA of cells was purified using TRIzol reagent (Invitrogen Life Technologies, Carlsbad, CA, USA) as described previously 10, 11. Nanog primers were designed: (forward) ATTCAGGACAGCCCTGATTCTTC and (reverse) TTTTTGCGACACTCTTCTCTGC.…”

Section: Methodsmentioning

confidence: 99%

“…The pLV-RNAi vector was purchased from Biosettia (San Diego, CA, USA). The method of cloning the double-stranded shRNA has been described previously 10, 11. Lentiviral vectors expressing shRNA that targets human Nanog (sh-Nanog-1: 5'-AAAAGCATCCGACTGTAAAGAATTTGGATCCAAATTCTTTACAGTCGGATGC-3'; sh-Nanog-2: 5'-AAAAGCTGTGTGTACTCAATGATTTGGATCCAAATCATTGAGTACACACAGC-3') were synthesized and cloned into pLVRNAi to generate a lentiviral expression vector.…”

Section: Methodsmentioning

confidence: 99%

“…HGFs were placed in 96-well plates, washed with phosphate-buffered saline, and cultured without fetal calf serum for starvation overnight. After treatment with 500 ng/mL CsA for 24 hours, cell growth was tested using the MTT [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide] assay kit (Sigma–Aldrich) as described previously 10, 11…”

Section: Methodsmentioning

confidence: 99%

“…It is believed that the imbalance of extracellular matrix (ECM) molecules accumulation may contribute to CsA-induced gingival overgrowth 3, 4, 5, 6, 7, 8, 9. Recently, the upregulation of epithelial–mesenchymal transition (EMT) makers Snail 10 and Slug 11 were also found to play an important role in the pathogenesis of CsA-induced gingival overgrowth.…”

Section: Introductionmentioning

confidence: 99%

See 4 more Smart Citations

Upregulation of embryonic stem cell marker Nanog in human gingival fibroblasts stimulated with cyclosporine A: An in vitro study

Liu

et al. 2017

Journal of Dental Sciences

Self Cite

View full text Add to dashboard Cite

Background/purpose Gingival overgrowth is a common side effect of medication with the immunosuppressant cyclosporine A (CsA). This study proposed to verify whether Nanog, an embryonic stem cell marker, contributes to gingival overgrowth stimulated with CsA in human gingival fibroblasts (HGFs). Materials and methods The effect of CsA on HGFs was used to elucidate whether Nanog expression could be induced by CsA using quantitative real-time reverse transcription-polymerase chain reaction and Western blotting. Cell growth in CsA-treated HGFs with Nanog lentivirus-mediated short hairpin RNA interference knockdown was evaluated by tetrazolium bromide reduction assay. Results CsA upregulated Nanog transcript in HGFs in a dose-dependent manner (P < 0.05). CsA was also shown to increase Nanog protein expression in HGFs in a dose-dependent manner (P < 0.05). In addition, downregulation of Nanog by lentiviral infection significantly inhibited CsA-stimulated cell growth in HGFs (P < 0.05). Conclusion CsA upregulated Nanog expression and cell growth in HGFs, while silencing Nanog effectively reversed these phenomena. Nanog may act as a major switch in the pathogenesis of CsA-induced gingival overgrowth.

show abstract

Section: Discussionmentioning

confidence: 95%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Methodsmentioning

confidence: 99%

Section: Introductionmentioning

confidence: 99%

See 3 more Smart Citations

Upregulation of embryonic stem cell marker Nanog in human gingival fibroblasts stimulated with cyclosporine A: An in vitro study

Liu

et al. 2017

Journal of Dental Sciences

Self Cite

View full text Add to dashboard Cite

show abstract

Negative feedback by SNAI2 regulates TGFβ1‐induced amelotin gene transcription in epithelial–mesenchymal transition

Nakayama

Tsuruya

Nöda

et al. 2018

Journal Cellular Physiology

View full text Add to dashboard Cite

Junctional epithelium (JE) demonstrates biological responses with the rapid turnover of gingival epithelial cells. The state occurs in inflammation of gingiva and wound healing after periodontal therapy. To understand the underlying mechanisms and to maintain homeostasis of JE, it is important to investigate roles of JE‐specific genes. Amelotin (AMTN) is localized at JE and regulated by inflammatory cytokines and apoptotic factors that represent a critical role of AMTN in stabilizing the dentogingival attachment, which is an entrance of oral bacteria. In this study, we demonstrated that the AMTN gene expression was regulated by SNAI2 and transforming growth factor β1 (TGFβ1)‐induced epithelial–mesenchymal transition (EMT) that occurs in wound healing and fibrosis during chronic inflammation. SNAI2 downregulated AMTN gene expression via SNAI2 bindings to E‐boxes (E2 and E4) in the mouse AMTN gene promoter in EMT of gingival epithelial cells. Meanwhile, TGFβ1‐induced AMTN gene expression was attenuated by SNAI2 and TGFβ1‐induced SNAI2, without inhibition of the TGFβ1‐Smad3 signaling pathway. Moreover, SNAI2 small interfering RNA (siRNA) rescued SNAI2‐induced downregulation of AMTN gene expression, and TGFβ1‐induced AMTN gene expression was potentiated by SNAI2 siRNA. Taken together, these data demonstrated that AMTN gene expression in the promotion of EMT was downregulated by SNAI2. The inhibitory effect of AMTN gene expression was an independent feedback on the TGFβ1‐Smad3 signaling pathway, suggesting that the mechanism can be engaged in maintaining homeostasis of gingival epithelial cells at JE and the wound healing phase.

show abstract

The regulation of Oct4 in human gingival fibroblasts stimulated by cyclosporine A: Preliminary observations

Liu

Lin

et al. 2020

Journal of Dental Sciences

View full text Add to dashboard Cite

Upregulation of Slug expression by cyclosporine A contributes to the pathogenesis of gingival overgrowth

Abstract: Taken together, upregulation of Slug in HGFs stimulated by CsA may play an important role in the pathogenesis of CsA-induced gingival overgrowth.

Cited by 11 publications

References 25 publications

Upregulation of embryonic stem cell marker Nanog in human gingival fibroblasts stimulated with cyclosporine A: An in vitro study

Upregulation of embryonic stem cell marker Nanog in human gingival fibroblasts stimulated with cyclosporine A: An in vitro study

Negative feedback by SNAI2 regulates TGFβ1‐induced amelotin gene transcription in epithelial–mesenchymal transition

The regulation of Oct4 in human gingival fibroblasts stimulated by cyclosporine A: Preliminary observations

Contact Info

Product

Resources

About