Up-regulation of carbon metabolism-related glyoxylate cycle and toxin production in Beauveria bassiana JEF-007 during infection of bean bug, Riptortus pedestris (Hemiptera: Alydidae)

Transcriptional response of bean bug (Riptortus pedestris) upon infection with entomopathogenic fungus, Beauveria bassiana JEF‐007

“…Our previous studies showed that the highly virulent strain of B. bassiana JEF‐007 can efficiently kill nymphs of the bean bug, R. pedestris . Additionally, we have identified the genes transcriptionally up‐regulated in B. bassiana after infecting the bean bug . In the present study, we have further identified the genes up‐regulated in R. pedestris nymphs infected by Bb JEF‐007 at a late‐stage.…”

“…The bean bug, R. pedestris is a sucking insect pest that is difficult to control with chemical insecticides because of its seasonal behavior and resistance to insecticides . An alternative is to use entomopathogens like the fungus, B. bassiana .…”

Relationship between expression level of hygromycin B-resistant gene andAgrobacterium tumefaciens-mediated transformation efficiency inBeauveria bassianaJEF-007

“…The B. bassiana γ‐actin gene served as an internal control and was amplified with F: 5′‐GTCAAGTCATCACCATTGGC‐3′ and R: 5′‐CGTAGAGATCCTTGCGAACA‐3′ ( T m : 60°C) (Yang et al . ). RT‐PCR was performed using the Thermo Scientific Verso SYBR Green 1‐step qRT‐PCR ROX Mix kit (Thermo‐Fisher Scientific, Carlsbad, CA) and the 96‐well Bio‐Rad CFX96 Real‐Time PCR System (Bio‐Rad).…”

“…Gene-specific primer sets for qRT-PCR were designed using an online program provided by GenScript (https://www.genscript.com/ssl-bin/app/primer), for hph (T-DNA5-F: 5 0 -AGT GCT TCA GCC GCT AC-3 0 and T-DNA5-R: 5 0 -CGT CCT CCT TGA AGT CG-3 0 ). The B. bassiana c-actin gene served as an internal control and was amplified with F: 5 0 -GTCAAGTCATCAC-CATTGGC-3 0 and R: 5 0 -CGTAGAGATCCTTGCGAACA-3 0 (T m : 60°C) (Yang et al 2016). RT-PCR was performed using the Thermo Scientific Verso SYBR Green 1-step qRT-PCR ROX Mix kit (Thermo-Fisher Scientific, Carlsbad, CA) and the 96-well Bio-Rad CFX96 Real-Time PCR System (Bio-Rad).…”

Metabolome- and genome-scale model analyses for engineering of Aureobasidium pullulans to enhance polymalic acid and malic acid production from sugarcane molasses

“…PMA has free carboxyl groups, making it simple to perform chemical modifications and create various derivatives or carrier-linked pro-drugs. Due to its unique properties, including high water solubility, biocompatibility, and biodegradability, PMA has attracted an increasing attention as a drug carrier or biomaterial in the past few years and is expected to have applications in the preparation of various polymeric micelles, microparticles, nanoconjugates, and nanoparticles for drug delivery systems [ 2 – 5 ]. PMA also has the potential to be used as a nano-imaging agent for safe and noninvasive diagnosis in the clinical setting [ 6 ].…”