UniquePrimer — a web utility for design of specific PCR primers and probes

Abstract

-We have developed a web-based tool for design of specific PCR primers and probes. The program allows you to enter primer sequence information as well as an optional probe, and sequence similarity searches (MegaBLAST) will be performed to see if the sequences match the same sequence entry in the specified database. If primers (and probe) match, this will be reported. The program can handle overlapping amplicons, amplification from a single primer, ambiguous bases and other problematic cases.

A strain of piscine myocarditis virus infecting Atlantic argentine, Argentina silus (Ascanius)

“…A previously described set of 342 RNA pools (1501 individuals) representing 32 marine fish species (Böckerman et al 2011) was screened using two conserved primers spanning a 711 nucleotide region of the genome (PMCVcons1F: ATTATGTAGG GATAAATGGGC and PMCVcons1R: GAAG AAATTAACGCTTTAGG). Primer selectivity was ensured using the program UniquePrimer (Nakken et al 2009). PCR was carried out using the Qiagen One-Step RT-PCR Kit, according to the manufac-turerÕs recommendations and the following PCR cycle: 30 min at 50°C (reverse transcription), 15 min at 94°C (reverse transcriptase inactivation and PCR polymerase activation), 45 cycles of 94°C/30 s, 55°C/30 s, 72°C/1 min and a final elongation step (3 min at 72°C).…”

“…2011) was screened using two conserved primers spanning a 711 nucleotide region of the genome (PMCVcons1F: ATTATGTAGGGATAAATGGGC and PMCVcons1R: GAAGAAATTAACGCTTTAGG). Primer selectivity was ensured using the program UniquePrimer (Nakken et al. 2009).…”

Selection of Optimal Primer Sets for Use in a Duplex Sybr Green-Based, Real-Time Polymerase Chain Reaction Protocol for the Detection of Listeria Monocytogenes and Staphyloccocus Aureus in Foods

“…(1999) appeared to be specific for L. monocytogenes when combined with probes. The inclusion of probes can circumvent nonspecific amplifications by providing an additional layer of specificity (Nakken et al . 2009).…”

“…Complementary PCR analysis showed nonspecific detection for selected species such as C. sakazakii, E. cloacae, S. aureus or V. parahaemolyticus. The PCR system developed by Scheu et al (1999) appeared to be The inclusion of probes can circumvent nonspecific amplifications by providing an additional layer of specificity (Nakken et al 2009). However, based on the current data, this primer set would not appear to be applicable for the subsequent development of a SYBR Green-based method for detection of L. monocytogenes.…”