Unbranched rod-like RNA is required for RNA editing of hepatitis delta virus genotype 2 and genotype 4

Investigating the Genetic Diversity of Hepatitis Delta Virus in Hepatocellular Carcinoma (HCC): Impact on Viral Evolution and Oncogenesis in HCC

“…RNA extraction from anti-HDV antibody-positive serum samples was performed using the QIAamp Viral RNA Mini Kit (QIAGEN, Hilden, Germany). Subsequently, reverse transcription was carried out with random hexamers and Moloney murine leukemia virus reverse transcriptase (Promega, Madison, WI, USA), adhering to the manufacturer’s instructions and a protocol described in a previous publication [ 27 ]. For HDV genotype determination, the synthesized cDNA underwent nested PCR using primer pairs 343 ( 853 TTCGGATGCCCAGGTCGGA 871 )/344 ( 1320 GGGTTCACCGACAAGGAGAG 1301 ) and 18/55′ [ 22 ], amplifying a partial region of the viral genome commonly employed for HDV genotyping.…”

“…For HDV genotype determination, the synthesized cDNA underwent nested PCR using primer pairs 343 ( 853 TTCGGATGCCCAGGTCGGA 871 )/344 ( 1320 GGGTTCACCGACAAGGAGAG 1301 ) and 18/55′ [ 22 ], amplifying a partial region of the viral genome commonly employed for HDV genotyping. The nucleotide numbering used here was based on HDV-2 TN2 clone with GenBank accession number MG557659 [ 27 ]. The PCR products were subsequently purified and directly sequenced using primer 18 [ 22 ].…”

“…Additionally, the amplified cDNA fragments were cloned into a commercial TA cloning vector (TOPO TA Cloning Vector; Invitrogen, Waltham, MA, USA). Multiple independent clones were gathered and analyzed through sequence analysis [ 27 ].…”

“…A full-length HDV replication clone, assembled from overlapping cDNA clones isolated from a serum sample of HDV-associated HCC 253, was constructed following procedures outlined in a previous report [ 27 ]. The complete genome sequence obtained from a serum sample of HCC 253, classified as HDV-2, was accessible in GenBank under Accession No.…”

“…The S-HDAg ORF of HCC 253 was obtained via PCR amplification using primers F4 [ 27 ] and 253N (gcggatcc- 1620 GAACTGAGGACCCTCGCCTCG 1605 ), with pCR3.1-D 1.2 253 serving as the template. Subsequently, the product underwent restriction enzyme digestion and was inserted into pCR3.1, yielding the S-HDAg expression plasmid of HDV-2 253, designated as pCR3.1-Sm253.…”