Ultrastructural aspects of the host cellular immune response to Taenia crassiceps metacestodes

Siebert, A.E.; Good, A.H.; Simmons, John E.

doi:10.1016/0020-7519(79)90082-1

Cited by 26 publications

(10 citation statements)

References 14 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Previous studies have shown that a primary SQ infection of T. crassiceps larvae can induce killing of a challenge infection of larvae (12)(13)(14). In none of these studies, however, was the killing response as immediate or effective as observed in our experiments (12).…”

Section: Discussioncontrasting

confidence: 74%

“…All RNA samples had an A 260 /A 280 ratio of between 1.5 and 2.0. Two micrograms of RNA was reverse transcribed in 40-l reactions using Moloney murine leukemia virus reverse transcriptase (Amersham Life Science, Inc., Cleveland, Ohio) at 200 U/l and oligo(dT) [12][13][14][15][16][17][18] (Pharmacia, Piscataway, N.J.) at 1 g/ml. cDNAs were precipitated and resuspended in deionized water, and then cytokine-specific cDNAs were amplified by PCR using the following conditions and primers: 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 0.11 mM each deoxynucleoside triphosphate, 2.3 pmol of each cytokine-specific primer (1) or ␤-actin-specific primer (3Ј primer, 5ЈCTCTTTGATGTCACGCACGATTTTC3Ј; 5Ј primer, 5ЈGACGAGG CGCAGAGCAAGAGAGG3Ј) per l, 1.15 mM MgCl 2 , and 1.3 U of AmpliTaq DNA polymerase (Perkin-Elmer, Branchburg, N.J.) in a 50-l reaction in Thermolyne oil-free tubes (Barnstead Thermolyne Corp., Dubuque, Iowa).…”

Section: Mice and Infectionsmentioning

confidence: 99%

See 1 more Smart Citation

Immune Destruction of LarvalTaenia crassicepsin Mice

et al. 2000

View full text Add to dashboard Cite

Immune destruction of larval Taenia crassiceps was examined by first injecting BALB/cJ mice subcutaneously with larval buds and 30 to 60 days later challenging the mice with larvae injected into the peritoneal cavity. The larvae injected intraperitoneally (i.p.) secondarily are killed by host cells that completely encase the larvae in a thick sheath. The peritoneal exudate cells and the cytokines they produced were characterized by flow cytometry, enzyme-linked immunosorbent assays (ELISAs), and reverse transcription PCR (RT-PCR). No changes in percentage of CD4؉ T cells, CD8 ؉ T cells, B1 cells, or macrophages were detected in the peritoneal cavities of mice that were killing larvae compared to mice with a primary 7-day infection i.p. Both RT-PCR and ELISA demonstrated a decrease in cytokines including gamma interferon (IFN-␥), interleukin-4 (IL-4), and IL-10 in mice that were killing the larvae compared to control mice infected for 30 to 60 days i.p. alone, although there was little difference compared to mice infected for 7 days i.p. alone. Serum cytokine levels in mice that were killing the larvae showed a decrease in IFN-␥ and IL-4, an increase in IL-10 when compared to mice infected for 30 to 60 days i.p. alone, and increases in all cytokines compared to mice infected for 7 days i.p. alone. Inhibition of nitric oxide production did not significantly affect the number or the viability of larvae in the peritoneal cavity of mice that were killing larvae during secondary infection.Human cysticercosis is a disease caused by the larval stage of the cestode parasite Taenia solium. Humans acquire the larvae by ingestion of eggs released from the adult tapeworm. Human cysticercosis is common in Mexico and underdeveloped countries and is increasing in prevalence in North America (5, 10, 11). Infection of the central nervous system leads to neurocysticercosis. An excellent model system for the study of this disease is infection of BALB/c mice with another taeniid parasite, Taenia crassiceps. The rodent is the natural intermediate host for this parasite, and the definitive host is a canine. The cysts multiply in the peritoneal cavity of the mouse by budding asexually in a seemingly uncontrolled manner, making the BALB/c mice extremely susceptible to infection. Analysis of the immune response that ensues during infection has shown that it is a mixed Th1/Th2 phenotype (15) that is ineffective in controlling parasite growth.To better determine immune responses that have the capacity to kill cestode larvae, a model system in which T. crassiceps larvae are immunologically killed in vivo was developed by a method similar to one reported earlier (12). In our work, it was found that a primary subcutaneous (SQ) infection of T. crassiceps larvae induces killing of larvae during a secondary intraperitoneal (i.p.) infection. In the present study, we report the conditions for inducing larval destruction, the effect of host responses to larvae SQ and i.p. as observed by scanning electron microscopy (EM), and the cell populations an...

show abstract

Section: Discussioncontrasting

confidence: 74%

Section: Mice and Infectionsmentioning

confidence: 99%

Immune Destruction of LarvalTaenia crassicepsin Mice

et al. 2000

View full text Add to dashboard Cite

show abstract

“…Two studies analysed larval T. crassiceps destruction in mice immunological primed by previous infection at a different site. The first study, in C3H mice primed by s.c. infection, observed that parasites in the peritoneal cavity were “encapsulated” by eosinophils and macrophages. In an initial phase (1‐4 weeks post‐infection), the encapsulating cells appeared to suffer degeneration.…”

Section: Taenia Crassicepsmentioning

confidence: 99%

“…With respect to eosinophil‐mediated killing, the descriptive evidence in favour is compelling, including ultrastructural observations of eosinophil degranulation and local damage to the parasite tegument . In an NCC model that uses intracranial injection of the taeniid Mesocestoides corti , the absence of eosinophils enhanced parasite loads .…”

Section: Do Granulomatous Responses Combat Larval Taeniid Infectionsmentioning

confidence: 99%

“…78,83,85 With respect to eosinophil-mediated killing, the descriptive evidence in favour is compelling, including ultrastructural observations of eosinophil degranulation and local damage to the parasite tegument. 58 In an NCC model that uses intracranial injection of the taeniid Mesocestoides corti, the absence of eosinophils enhanced parasite loads. 131 In secondary peritoneal CE in mice, impaired recruitment of eosinophils (but not any of the other major cell types) in the absence of complement C5 was associated with higher parasite burdens.…”

Section: Do G R An Ulomatous Re S P On S E S Combat L Arval Taeniidmentioning

confidence: 99%

See 1 more Smart Citation

Granulomatous responses in larval taeniid infections

Díaz

Sagasti

Casaravilla

2018

Parasite Immunology

View full text Add to dashboard Cite

Granulomas are responses to persistent nonliving bodies or pathogens, centrally featuring specialized macrophage forms called epithelioid and multinucleated giant cells. The larval stages of the cestode parasites of the Taeniidae family (Taenia, Echinococcus) develop for years in fixed tissue sites in mammals. In consequence, they are targets of granulomatous responses. The information on tissue responses to larval taeniids is fragmented among host and parasite species and scattered over many decades. We attempt to draw an integrated picture of these responses in solid tissues. The intensity of inflammation around live parasites spans a spectrum from minimal to high, parasite vitality correlating with low inflammation. The low end of the inflammatory spectrum features collagen capsules proximal to the parasites and moderate distal infiltration. The middle of the spectrum is dominated by classical granulomatous responses, whereas the high end features massive eosinophil invasions. Across the range of parasite species, much observational evidence suggests that eosinophils are highly effective at killing larval taeniids in solid tissues, before and during chronic granulomatous responses. The evidence available also suggests that these parasites are adapted to inhibit host granulomatous responses, in part through the exacerbation of host regulatory mechanisms including regulatory T cells and TGF-β.

show abstract

Peptides: An Emerging Force in Host Responses to Parasitism

Fairweather¹

1997

Parasites and Pathogens

View full text Add to dashboard Cite

Ultrastructural aspects of the host cellular immune response to Taenia crassiceps metacestodes

Cited by 26 publications

References 14 publications

Immune Destruction of LarvalTaenia crassicepsin Mice

Immune Destruction of LarvalTaenia crassicepsin Mice

Granulomatous responses in larval taeniid infections

Peptides: An Emerging Force in Host Responses to Parasitism

Contact Info

Product

Resources

About