Type I IFN Inhibits Innate IL-10 Production in Macrophages through Histone Deacetylase 11 by Downregulating MicroRNA-145

Lin, Li; Hou, Jin; Ma, Feng; Wang, Pin; Liu, Xingguang; Li, Nan; Wang, Jianli; Wang, Qingqing; Cao, Xuetao

doi:10.4049/jimmunol.1203450

Cited by 62 publications

(41 citation statements)

References 49 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…STAT1 and -2 respond to interferons (IFNs), thereby promoting IFN-stimulated genes and antiviral immunity. STAT3 responds to factors including IL-6, IL-10, and vascular endothelial growth factor and is involved in T-helper cell 17 (Th17) and Treg cell development and tumorigenesis (Lin et al, 2013;Nieminen et al, 2013). STAT4 and STAT6 control Th1 and Th2 cell differentiation in response to IL-12 and IL-4/13, respectively (Fontan and Melnick, 2013;Meisch et al, 2013;Singh et al, 2013).…”

Section: Discussionmentioning

confidence: 99%

MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis

Song¹,

Wang²,

Geng³

2015

Genet. Mol. Res.

View full text Add to dashboard Cite

ABSTRACT. Sepsis is a major cause of morbidity and mortality in critically ill patients. The sepsis syndrome results from a dysregulated inflammatory response to infection that leads to multiple-organ failure, but the underlying mechanisms remain poorly understood. More and more reports show that microRNAs (miRNAs) play an important role in sepsis. In the progression of this syndrome, cells change their behavior in response to cytokines stimulated by sepsis, such as interleukin-10 (IL-10). IL-10 can activate JAK2-STAT3 in the cells to protect them from damage. miR-29a is a potential miRNA directly targeting STAT3. In this study, we investigate the role of miR-29a in targeting STAT3 during sepsis. When cells were treated with IL-10, STAT3 was activated in monocytes, as determined using western blotting. It was verified that STAT3 was a new target gene of miR-29a. miR-29a could inhibit IL-10-induced cytokine release by targeting JAK-STAT3 in monocytes. In conclusion, this study demonstrates for the first time that miR-29a inhibits STAT3 in human monocytes during sepsis.

show abstract

Section: Discussionmentioning

confidence: 99%

MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis

Song¹,

Wang²,

Geng³

2015

Genet. Mol. Res.

View full text Add to dashboard Cite

show abstract

“…The iRhom2 plasmid and empty vector (EV), as well as NF-κB, TACE, TNFR2 and TNFR1 luciferase reporter plasmids were constructed as previously described by standard molecular biology techniques [27], [28], [29]. All constructs were confirmed by DNA sequencing.…”

Section: Methodsmentioning

confidence: 99%

iRhom2 loss alleviates renal injury in long-term PM2.5-exposed mice by suppression of inflammation and oxidative stress

Qin

et al. 2018

Redox Biology

View full text Add to dashboard Cite

Particulate matter (PM2.5) is a risk factor for organ injury and disease progression, such as lung, brain and liver. However, its effects on renal injury and the underlying molecular mechanism have not been understood. The inactive rhomboid protein 2 (iRhom2), also known as rhomboid family member 2 (Rhbdf2), is a necessary modulator for shedding of tumor necrosis factor-α (TNF-α) in immune cells, and has been explored in the pathogenesis of chronic renal diseases. In the present study, we found that compared to the wild type (iRhom2+/+) mice, iRhom2 knockout (iRhom2-/-) protected PM2.5-exposed mice from developing severe renal injury, accompanied with improved renal pathological changes and functions. iRhom2-/- mice exhibited reduced inflammatory response, as evidenced by the reduction of interleukin 1β (IL-1β), IL-6, tumor necrosis factor-α (TNF-α) and IL-18 in kidney samples, which might be, at least partly, through inactivating TNF-α converting enzyme/TNF-α receptors (TACE/TNFRs) and inhibitor of α/nuclear factor κ B (IκBα/NF-κB) signaling pathways. In addition, oxidative stress was also restrained by iRhom2-/- in kidney of PM2.5-exposed mice by enhancing heme oxygenase/nuclear factor erythroid 2-related factor 2 (HO-1/Nrf-2) expressions, and reducing phosphorylated c-Jun N-terminal kinase (JNK). In vitro, blockage of HO-1 or Nrf-2 rescued the inflammatory response and oxidative stress that were reduced by iRhom2 knockdown in PM2.5-incubated RAW264.7 cells. Similar results were observed in JNK activator-treated cells. Taken together, our findings indicated that iRhom2 played an essential role in regulating PM2.5-induced chronic renal damage, thus revealing a potential target for preventing chronic kidney diseases development.

show abstract

“…For Smyd2 catalytic mutant Y240F point mutation construction, primers 5Ј CGAGGTGTTCAC-CAG CTTCATCGACCTGCTATATCC; 3Ј GGATATAG-CAGGTCGATGAAGCTGGTGAACACCTCG were used. The Il6 and Tnf luciferase reporter plasmids were constructed as described previously (23,29,30). The pGL3 luciferase vector and internal control TK plasmid were purchased from Promega.…”

Section: T Cell Differentiation and Coculture With Macrophagespurifiementioning

confidence: 99%

The Histone Methyltransferase Smyd2 Is a Negative Regulator of Macrophage Activation by Suppressing Interleukin 6 (IL-6) and Tumor Necrosis Factor α (TNF-α) Production

Liu

Xiong

et al. 2015

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

Type I IFN Inhibits Innate IL-10 Production in Macrophages through Histone Deacetylase 11 by Downregulating MicroRNA-145

Cited by 62 publications

References 49 publications

MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis

MicroRNA-29a promotes apoptosis of monocytes by targeting STAT3 during sepsis

iRhom2 loss alleviates renal injury in long-term PM2.5-exposed mice by suppression of inflammation and oxidative stress

The Histone Methyltransferase Smyd2 Is a Negative Regulator of Macrophage Activation by Suppressing Interleukin 6 (IL-6) and Tumor Necrosis Factor α (TNF-α) Production

Contact Info

Product

Resources

About