Two Systems for Conditional Gene Expression in Myxococcus xanthus Inducible by Isopropyl-β- d -Thiogalactopyranoside or Vanillate

Abstract

Conditional expression of a gene is a powerful tool to study its function and is typically achieved by placing the gene under the control of an inducible promoter. There is, however, a dearth of such inducible systems in Myxococcus xanthus, a well-studied prokaryotic model for multicellular development, cell differentiation, motility, and light response and a promising source of secondary metabolites. The few available systems have limitations, and exogenously based ones are unavailable. Here, we describe two new, versatile inducible systems for conditional expression of genes in M. xanthus. One employs isopropyl-␤-D-thiogalactopyranoside (IPTG) as an inducer and is inspired by those successfully applied in some other bacteria. The other requires vanillate as an inducer and is based on the system developed originally for Caulobacter crescentus and recently adapted for mammalian cells. Both systems are robust, with essentially no expression in the absence of an inducer. Depending on the inducer and the amounts added, expression levels can be modulated such that either system can conditionally express genes, including ones that are essential and are required at high levels such as ftsZ. The two systems operate during vegetative growth as well as during M. xanthus development. Moreover, they can be used to simultaneously induce expression of distinct genes within the same cell. The conditional expression systems we describe substantially expand the genetic tool kit available for studying M. xanthus gene function and cellular biology.

Data-driven modeling reveals cell behaviors controlling self-organization during Myxococcus xanthus development

“…Development was induced on 10 mL TPM agar [10 mM Tris·HCl (pH 7.6), 1 mM KH(H 2 )PO 4 (pH 7.6), 10 mM MgSO 4 , 1.5% agar (Difco)] containing 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and 100 μM vanillate in 100-mm diameter Petri dishes. pLJS145 was constructed by PCR cloning tdTomato from ptdTomato with primers containing 3′-XbaI and 5′-KpnI restriction sites and ligated into pMR3487 (50). pCRC36 was constructed by PCR cloning the eYFP from pEYFP with primers containing 3′-NdeI and 5′-NheI restriction sites and ligated into pMR3629 (50).…”

“…pLJS145 was constructed by PCR cloning tdTomato from ptdTomato with primers containing 3′-XbaI and 5′-KpnI restriction sites and ligated into pMR3487 (50). pCRC36 was constructed by PCR cloning the eYFP from pEYFP with primers containing 3′-NdeI and 5′-NheI restriction sites and ligated into pMR3629 (50). Strains LS3629 and LS3908 were constructed by electroporation (51) of plasmids pCRC36 and pLJS145, respectively.…”

Cell rejuvenation and social behaviors promoted by LPS exchange in myxobacteria

“…4B), we wanted to confirm that the phenotype was specifically lpxC dependent. We thus complemented the mutation by ectopic lpxC expression from an isopropyl β-D-1-thiogalactopyranoside (IPTG)-inducible promoter (29). In the presence of either vanillate or IPTG, the strain behaved and morphologically appeared as WT, whereas in the absence of both inducers the cells lysed (Fig.…”

Spontaneous Reversions of an Evolutionary Trait Loss Reveal Regulators of a Small RNA That Controls Multicellular Development in Myxobacteria

“…Using GJV1 genomic DNA as the template, the fragment was obtained by PCR amplification with primers GV397 (TCCTTGCCCG TGCCGCTCTCG) and GV696 (AACATATGAGTACCAAGCGCTAC AGCG), which was tailored with an NdeI restriction enzyme site (underlined). The insert was cut out of pCR-pxrK by NdeI/BamHI double digestion and was cloned into the NdeI/BglII-linearized plasmid pMR3629 (34). The resulting plasmid, pMRpxrK, which positions pxrK under the control of the vanillate-inducible promoter P van , was integrated into PXL21 to generate PXL21::pMRpxrK.…”