Two novel mitogenomes of Dipodidae species and phylogeny of Rodentia inferred from the complete mitogenomes

Whole mitochondrial genome sequence and phylogenetic relationships of Williams’s jerboa (Scarturus williamsi) from Turkey

“…This incomplete termination codon can form a complete termination codon through post-transcriptional polyadenylation ( Ojala, Montoya & Attardi, 1981 ). When compared with the available Dipodoidea mitogenomes, the S. williamsi mitogenome showed was a deletion of a serine residue at the C-terminus of the ATP8 gene, similar to observations reported by Yue et al (2015) for E. setchuanus and S. concolor . However, this deletion was not observed in the mitogenomes of D. sagitta , J. jaculus and E. naso .…”

“…It also included twelve 22 bp-long (CATACACACGTACACGCATACG) and one 11 bp-long tandem repeat elements totaling 275 bp in length. A similar pattern, that is, 6–14 bp-long motifs repeated in various numbers was previously observed in the mitogenomes of other Dipodoidea members ( Yue et al, 2015 ; Ding et al, 2016 ; Luo & Liao, 2016 ; Luo, Ding & Liao, 2016 ; Reyes et al, 2016 , ). In this context, the longest tandem repeat motif was observed in the S. williamsi mitogenome.…”

“…While 344 amino acids are encoded by ND2 in Muridae species and S. concolor , 345 amino acids are encoded by ND2 in Cricetidae species ( Yue et al, 2015 ). By comparison, 347 amino acids are encoded by ND2 in S. williamsi (This Study) and in a great majority of the remaining rodents ( Yue et al, 2015 ). Relative Synonymous Codon Usage (RSCU) and codon usage analyses of the mitogenome are presented in Fig.…”

“…However, a single mitochondrial gene or region may be insufficient to resolve phylogenetic relationships ( Steppan & Schenk, 2017 ). Because of the rich content of phylogenetically informative sites, whole mitochondrial genome (hereinafter referred to as mitogenome) data can provide more reliable and robust results ( Yang, Xue & Han, 2013 ; Yue et al, 2015 ). The data obtained from mitogenomes in recent years have enabled a better understanding of the phylogenetic relationships within various mammalian families (i.e., Bovidae and Cervidae ( Wada et al, 2010 ), Cricetidae ( Ding et al, 2019 ), Ursidae ( Krause et al, 2008 ), Viverridae ( Mitra et al, 2019 )).…”

“…The data obtained from mitogenomes in recent years have enabled a better understanding of the phylogenetic relationships within various mammalian families (i.e., Bovidae and Cervidae ( Wada et al, 2010 ), Cricetidae ( Ding et al, 2019 ), Ursidae ( Krause et al, 2008 ), Viverridae ( Mitra et al, 2019 )). However, the mitogenome data of Dipodoidea species are limited; indeed, data of only a few species (e.g., Orientallactaga sibirica , Dipus sagitta , Euchoreutes naso , Eozapus setchuanus , Jaculus jaculus , Sicista concolor , Stylodipus telum ) ( Yue et al, 2015 ; Ding et al, 2016 ; Luo & Liao, 2016 ; Luo, Ding & Liao, 2016 ; Reyes et al, 2016 , ) are available. Thus far, the complete mitogenome sequence of S. williamsi has not been characterized and the taxonomic status and phylogenetic relationships of this species within Dipodoidea remain debated because of the limited molecular data currently available.…”