Two Domains within the Adenovirus Type 12 E1A UniqueSpacerHave Disparate Effects on the Interaction of E1A with P105-Rb and the Transformation of Primary Mouse Cells

Abstract

Transformation of primary rodent cells by functions of the adenovirus type 12 (Ad12) early region 1 (E1) is reduced severalfold compared with transformation by E1 of Ad2. We analyzed whether the unique spacer region of Ad12 E1A that borders the conserved region (CR) 2 and represents an oncogenic determinant of Ad12 E1A is involved in this impaired transformation property, putatively by modulating transformation-relevant biological E1A functions. We show that a mutant (E1ASpm1) that lacks 12 amino-terminal residues of the spacer binds p105-Rb and p130 as Ad12 E1A wild type (E1Awt), whereas a second spacer mutant (E1ASpm2) that lacks an adjacent stretch of six alanines exhibits highly reduced binding to p105-Rb. The binding of this mutant to the p130 pocket protein is, however, little impaired. E1ASpm1 diminishes the formation of the p105-Rb-E2F complex more efficiently than E1Awt or, least efficient, E1ASpm2. These properties of the spacer mutants to target and to disintegrate the p105-Rb-E2F complex correspond with their ability to transform primary mouse cells in combination with E1B: E1ASpm1 (plus Ad12 E1B)-transfected cells could be easily established as cell lines, comparable to Ad12 E1Awt- or Ad2 E1Awt-transfected cells. In contrast, cells transfected with E1ASpm2 or Ad12 E1AdelCR2 (lacking the entire CR2) died within 6-10 weeks after replating, although foci were formed in all cases. Of note, the E1ASpm1-transformed cells grow as fast as the Ad2 E1Awt-transformed cells, with a doubling rate of 15 h, whereas the doubling of the Ad12 E1Awt-transformed cells takes approximately 120 h. Moreover, in the established cell lines, the affinity of E1ASpm1 to p105-Rb was higher than with that of E1Awt. Our data suggest the presence of a transformation-suppressing domain within the carboxyl-terminal 12 residues of the Ad12 E1A-unique spacer, whereas the hydrophobic stretch of six alanines in the spacer is required for stable transformation.

Rb2/p130 and protein phosphatase 2A: key mediators of ovarian carcinoma cell growth suppression by all-trans retinoic acid

“…These include histone deacetylase 1 (Rayman et al, 2002), protein phosphatase 1 (Dunaief et al, 2002), and BRCA1 (Fan et al, 2001). Many viral proteins such as adenovirus E1A (Nielsch et al, 1991;Guilhot et al, 1993;Missero et al, 1993;Putzer et al, 1997;Rumpf et al, 1999), human papiloma virus E7 (Banks et al, 1990;Schmitt et al, 1994;Jones et al, 1997;Wang et al, 1997;Liu et al, 2000), and SV40 large T antigen (Hu et al, 1990) contain this sequence and as such are also able to bind to the Rb family of proteins.…”

Interaction of Adenovirus E1A with the HHV8 Promoter of Latent Genes: E1A Proteins are Able to Activate the HHV-8 LANAp in MV3 Reporter Cells

“…The Sp-1 binding site was deleted according to the instructions of the manufacturer using the two primers 5´-GTCCCGGGCGCCGCGTAGTGGAAGTTATATCAAG CTACTTTCTGATTG-3´ (sense) and 5´-CAATCAGAAAG TAGCTTGATATAACTTCCACTACGCGGCGCCCGGGA C-3´ (antisense) with the reporter gene plasmid and the 88 bp HHV-8 as templates. The E1A mutants used in this study were described previously [ 46 , 47 , 51 ]. The Spm2 construct expressed the Spm2 E1A mutant fused to the herpes virus VP22 tegument protein to increase intercellular spread [ 53 ].…”

“…Since HHV-8 has been reported to latently infect a variety of adherent tumor cell lines of epithelial, endothelial, and mesenchymal origin [ 45 ], we used a reporter cell system throughout this study. In efforts to further improve the safety of E1A for clinical use we had found that in principle it is possible to separate transforming and reversing functions in a melanoma model [ 46 , 47 ] and thus included respective deletion mutants of E1A in the present study. Here we report on activation of the LANAp in E1A-transfected cells.…”

The Retinoblastoma Family Protein p130 as a Negative Regulator of Cell Growth and Tumor Progression

“…E1A contains an LXCXE motif that is responsible for this interaction (Whyte, et al 1989;Nielsch et al, 1991;Rumpf et al, 1999). The pRB pocket domain has been co-crystallized with an LXCXE peptide, allowing localization of the LXCXE binding site on the inside of its B domain sequence (Lee et al, 1998).…”