TWIST1 Silencing Enhances In Vitro and In Vivo Osteogenic Differentiation of Human Adipose-Derived Stem Cells by Triggering Activation of BMP-ERK/FGF Signaling and TAZ Upregulation

Abstract

Mesenchymal stem cells (MSCs) show promise for cellular therapy and regenerative medicine. Human adipose tissue-derived stem cells (hASCs) represent an attractive source of seed cells in bone regeneration. How to effectively improve osteogenic differentiation of hASCs in the bone tissue engineering has become a very important question with profound translational implications. Numerous regulatory pathways dominate osteogenic differentiation of hASCs involving transcriptional factors and signaling molecules. However, how these factors combine with each other to regulate hASCs osteogenic differentiation still remains to be illustrated. The highly conserved developmental proteins TWIST play key roles for transcriptional regulation in mesenchymal cell lineages. This study investigates TWIST1 function in hASCs osteogenesis. Our results show that TWIST1 shRNA silencing increased the osteogenic potential of hASCs in vitro and their skeletal regenerative ability when applied in vivo. We demonstrate that the increased osteogenic capacity observed with TWIST1 knockdown in hASCs is mediated through endogenous activation of BMP and ERK/FGF signaling leading, in turn, to upregulation of TAZ, a transcriptional modulator of MSCs differentiation along the osteoblast lineage. Inhibition either of BMP or ERK/FGF signaling suppressed TAZ upregulation and the enhanced osteogenesis in shTWIST1 hASCs. Cosilencing of both TWIST1 and TAZ abrogated the effect elicited by TWIST1 knockdown thus, identifying TAZ as a downstream mediator through which TWIST1 knockdown enhanced osteogenic differentiation in hASCs. Our functional study contributes to a better knowledge of molecular mechanisms governing the osteogenic ability of hASCs, and highlights TWIST1 as a potential target to facilitate in vivo bone healing.

The Role of Pannexin3-Modified Human Dental Pulp-Derived Mesenchymal Stromal Cells in Repairing Rat Cranial Critical-Sized Bone Defects

“…The ERK signaling pathway is important in osteogenic commitment of various cell types [24,31,32]. In the present study, we demonstrated that Panx3 overexpression enhanced ERK activity.…”

Role of tumor microenvironment in tumorigenesis

“…In turn, cancer cells may express the corresponding markers. Although there is no unique marker for clinical identification, the increase or decrease in the number of a substance in adipose tissue may directly or indirectly reflect the initiation, progression, and invasion of the tumor, such as the EMT-like phenotypic alterations accompanied by the upregulation of matrix metallopeptidase 9 (MMP9) and TWIST1 202, 203. Higher aromatase activity and higher degrees of obesity may abate the efficacy of aromatase inhibitors 204.…”

Small Molecule Inhibition of Transforming Growth Factor Beta Signaling Enables the Endogenous Regenerative Potential of the Mammalian Calvarium

“…mCT was performed using a high-resolution MicroCAT IIÔ (ImTek, Inc.) small animal imaging system, with previously described settings. 46 Two-dimensional projection images were used to reconstruct tomograms with a commercial software package (Cobra EXXIM; EXXIM Computing Corp.), resulting in a resolution of 80 mm. Three-dimensional reconstructions were generated by MicroView software (GE Healthcare).…”

“…Mineralization of the extracellular matrix was assessed by alizarin red staining and quantification at days 21-28 of the differentiation as previously described. 46 RNA isolation, reverse transcription, and quantitative real time polymerase chain reaction Total RNA isolation, reverse transcription-polymerase chain reaction (RT-PCR), quantitative PCR (qPCR), primers sequence for mouse and human Runx2, Bglap, and Gapdh, and annealing temperature were previously described. 11,13,47 Specific primers for Bmp2 and Smad6 and Id2 were designed based on their GenBank sequence, and sequences are as follows: mSmad6Fwd:TACCACTTCAGCCGGCCTCTG; mSmad6Rev:AGTACGCCACGCTGCACCAGT; mBmp2Fwd: ACCCGCTGTCTTCTAGTGTTG; mBmp2Rev:TCTCTGC TTCAGGCCAAACA; mId2Fwd:GATGATCGTCTTGCCC AGGT; mId2Rev:TCTGGTATTCACGCTCCACC annealing at 57°C.…”