Twist1 Induces CCL2 and Recruits Macrophages to Promote Angiogenesis

Abstract

The transcription factor Twist1 induces Epithelial-Mesenchymal Transition and extracellular matrix degradation to promote tumor metastasis. Although Twist1 also plays a role in embryonic vascular development and tumor angiogenesis, the molecular mechanisms that underlie these processes are not as well understood. Here, we report a novel function for Twist1 in modifying the tumor microenvironment to promote progression. We found that expression of Twist1 in human mammary epithelial cells potently promoted angiogenesis. Surprisingly, Twist1 expression did not increase the secretion of the common pro-angiogenic factors VEGF and bFGF, but rather induced expression of the macrophage chemoattractant CCL2. Attenuation of endogenous Twist1 in vivo blocked macrophage recruitment and angiogenesis, whereas exogenous CCL2 rescued the ability of tumor cells lacking Twist1 to attract macrophages and promote angiogenesis. Macrophage recruitment also was essential for the ability of Twist1-expressing cells to elicit a strong angiogenic response. Together, our findings show how Twist1 recruits stromal macrophages through CCL2 induction to promote angiogenesis and tumor progression. Since Twist1 expression has been associated with poor survival in many human cancers, this finding suggests that anti-CCL2 therapy may offer a rational strategy to treat Twist1-positive metastatic cancers.

Implications of Akt2/Twist crosstalk on breast cancer metastatic outcome

“…By binding to E-boxes of the ER promoter and downregulating its activity, Twist1 also endows BC cells with resistance to hormone therapy [40]. Additionally, Twist1 involvement in angiogenesis by enhancing expression of the macrophage chemoattractant chemokine (C-C motif) ligand 2 (CCL2) in metastatic BC cells, with subsequent macrophage recruitment towards tumor microenvironment, was also reported [41]. Lastly, Twist1 has also been shown to be implicated in BC invasiveness and metastatic dissemination by regulating ECM degradation.…”

Considerations for the Development of Innovative Therapies Against Aggressive Neuroblastoma: Immunotherapy and Twist1 Targeting

“…Recent papers suggest that oncogenes playing key role in transformation might also play a role in protumoral microenvironment properties [42]. This is true for TWIST1 since its overexpression was reported correlated with increased vascularization in breast carcinoma [43].…”

“…In fact, Twist1 does not directly induce vEGF production by tumor cells but rather chemokines like CCL2 that are attractive for vEGF-producer macrophages. Their homing in tumor microenvironment site and production of vEGF contribute to metastasis [42]. In aggressive NMA neuroblastoma, it was shown that TAMs are correlated to bad prognosis [10].…”

Specific tumor-derived CCL2 mediated by pyruvate kinase M2 in colorectal cancer cells contributes to macrophage recruitment in tumor microenvironment

“…RNA was subjected to complementary DNA (cDNA) synthesis and RT-qPCR using All-in-One First-Strand cDNA Synthesis Kit and All-in-One™ qPCR Mix (GeneCopoeia) according to the manufacturer's protocol. human CCL2 (hCCL2): CAGCCAGATGCAATCAAT GCC, TGGAATCCTGAACCCACTTCT human GAPDH (hGAPDH): GAGAGACCCTCACTG CTG, GATGGTACATGACAAGGTGC 30 …”