Türk Yağlı Kuyruklu Koyun Irklarındaki Beta-Laktoglobulin Gen Tipleri

Şahin, Emine; Karslı, Taki; Elmacı, Cengiz; Balcıoğlu, Murat Soner

doi:10.9775/kvfd.2011.4476

Cited by 2 publications

(3 citation statements)

References 8 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Similar findings were obtained in Kıvırcık (0.7759), Gökçeada (0.7632), and Sakız (0.9756) sheep breeds by Elmaci et al (2006); Awassi (0.6316), Tuj (0.7188), Norduz (0.7059), and Güney Karaman (0.6552) sheep breeds by Sahin et al (2011).Similarly, Çelik and Özdemir (2006) reported that the A allele frequencies determined in Awassi and Morkaraman sheep were 0.63 and 0.56, respectively. Sahin et al (2011) showed that the BLG B allele was high in Dağlıç, Akkaraman, Karakaş, and Kangal sheep. This differs from the findings presented here in Norduz sheep.…”

Section: Discussionsupporting

confidence: 79%

“…AB genotype (0.70) in the study was the most common genotype in the Norduz breed. Similar results for the genotype of ovine BLG in Awassi, Dağlıç, Akkaraman, Karakaş, Norduz, Güney Karaman, and Kangal sheep breeds were reported by Sahin et al (2011).On the other hand, this study was inconsistent with the results reported for HWE by Sahin et al (2011).…”

Section: Discussioncontrasting

confidence: 63%

See 1 more Smart Citation

Investigation of Genetic Polymorphisms of CSN1S1 and BLG Genes in Norduz sheep by PCR-RFLP method

Çak,

Yılmaz,

Demirel

2024

J Hellenic Vet Med Soc

View full text Add to dashboard Cite

This study was undertaken to examine genetic polymorphisms of Alpha-S1 casein (CSN1S1) and β-Lactoglobulin (BLG) genes in Norduz sheep by PCR-RFLP method. In the study, 10 ml blood samples were taken from 102 heads of Norduz sheep into tubes with EDTA. DNA isolation from blood samples was done with ready-made commercial kits. The target DNA region of alpha-s1 casein and beta-lactoglobulin genes was amplified by PCR technique. The obtained PCR patterns were digested with MboII and RsaI restriction enzymes to determine the genotypes of Alpha-S1 casein and β-lactoglobulin genes, respectively. The cut fragments were run on 2% agarose gel electrophoresis and genotypes were determined under UV light. Statistical analysis, after calculating allele and genotype frequencies by direct gene counting method, the distribution of observed and expected genotypic frequencies was determined according to the Hardy-Weinberg Equilibrium, and whether it was compatible with the χ2 test. β-Lactoglobulin AA, AB and BB genotype frequencies were found to be 17.6%, 69.6 and 12.7%, respectively. It was determined that the β-Lactoglobulin gene was not in Hardy-Weinberg Equilibrium. AlphaS1-Casein AA, AC and CC genotype frequencies were determined as 0.0, 2.9 and 97.1%, respectively. The Alpha-S1 casein gene was determined to be in Hardy-Weinberg equilibrium. It was determined that Norduz sheep showed polymorphism in terms of Alpha-S1 Casein and β-Lactoglobulin genes. In conclusion, it was determined that the A allele of the β-Lactoglobulin gene and the AB genotype were more common, the C allele and the CC genotype of the Alpha-S1 casein gene were more common, and the AA genotype was absent in Norduz sheep. It was concluded that it would be useful to investigate the economic effects of genetic polymorphisms of Alpha-S1 casein and β-Lactoglobulin genes on various yield traits in larger Norduz sheep populations.

show abstract

Section: Discussionsupporting

confidence: 79%

Section: Discussioncontrasting

confidence: 63%

Investigation of Genetic Polymorphisms of CSN1S1 and BLG Genes in Norduz sheep by PCR-RFLP method

Çak,

Yılmaz,

Demirel

2024

J Hellenic Vet Med Soc

View full text Add to dashboard Cite

show abstract

“…PCR was done according to the protocol 13,17 with minor modifications. The primer set of "forward; 5-TGGA TGGACCGGCGAGACAAGCGTCGAGATGCTGCTGGACATGGGGCTGAGCCATGTAATAATAGGACA CTCTGAAAGACGTAGAATCATGGGCGAGACCAATGAGCAGAGTGCTAAGAAGGCGAAGCGTGCTC TGGACAAAGGTATGACTGTTATCTTCTGCACCGGAGAGACCCTGGATGAACGCAAGGCCAATAACA CTATGGAGGTGAATATTGCTCAGC^TCGAGGCTCTTAAGAAGGAGATTGGAGAATCAAAGAAGTTA TGGGAGAACGTTGTAATGCCTATGAGCCGGTGTGGTCTATCGGCACGGGTGTGGTGGCCACACCG GAGCAGGCAGAGGAAGTCCATGTGGGACTCCGCAAATGGTTTGCGGAAAAGGTTTGCGCAGAAGG TGCGCAGCACATCCGCATCATCTATGGAGGGTCTGCCAATGGGAGTAACTGCGAGAAGCTTGGCCA GTGCCCGAATATCGACGGATTCCTCGTCGGAGGTGCTTCCCTCAAGCCGGA (Fig.…”

Section: Pcrmentioning

confidence: 99%

Bir Türk Hasta Kohortunda Giardia lamblia Genotiplendirilmesi: Semptomlar ile Genotipler Arası İlişkinin Araştırılması

Balcıoğlu¹,

Kurt²,

Sevil³

et al. 2009

Kafkas Univ Vet Fak Derg

View full text Add to dashboard Cite

SummaryRecent surveys investigating the molecular biology of Giardia lamblia revealed two distinct assemblages with different clinical outcomes. However, there is not a universal compromise about the clinical effects of each assemblage, warranting further studies. Here, we report the results of the first analyses of the assemblages of G. lamblia in Manisa province located in western Turkey, together with their relationships with the symptoms and DNA sequence analyses of the PCR products. DNA samples were isolated from the stools of 63 patients infected with G. lamblia and 54 DNA samples, amplified successfully with PCR, were digested with the enzyme Xho I for RFLP. Thirty-eight of 54 samples (70.4%) were found to be in Assemblage A, while the remaining 16 samples (29.6%) were found to be in Assemblage B. The number of female patients was found significantly higher in Assemblage B (P=0.18). There was a statistically significant relationship between the occurrence of both abdominal pain and diarrhea and Assemblage B (chi-square, 10.52; P<0.05). No other statistically significant relationship was detected between the assemblages and neither with the symptoms nor with the age groups of the patients. The comparison of the DNA sequences of the PCR products from two assemblage B (one subtype B1 and one B) and one assemblage A samples both with each other and with other DNA sequences in the NCBI website by multialignment analyses, revealed specific regions for assemblages B (B1-B) and A on tpi gene region. Further studies with more patients are required to assess these initial results. Now, our aim is to design a probe for tpi gene region to set up a real-time PCR assay that is easier to conduct and requiring shorter time for the analyses. Keywords: Giardia lamblia, Diagnosis, PCR, Genotyping, SymptomBir Türk Hasta Kohortunda Giardia lamblia Genotiplendirilmesi: Semptomlar ile Genotipler Arası İlişkinin Araştırılması ÖzetGiardia lamblia ile yapılan moleküler düzeydeki çalışmalar iki farklı genotipin farklı klinik belirtilere sahip olduğunu ortaya çıkarmıştır. Bununla birlikte, hangi genotipin ne tür klinik belirtilere neden olduğuna dair henüz kesin bulgular elde edilmiş değildir. Bu araştırmada Türkiye'nin Manisa yöresinden elde edilen G. lamblia izolatları polimeraz zincir reaksiyonu (PZR) ve sonrasında DNA dizi analizi yöntemleriyle araştırılmış ve saptanan genotipler ile hastalardaki klinik semptomlar arasındaki ilişkiler incelenmiştir. Toplam 63 hastadan DNA örnekleri izole edilmiş ve bunların 54'üne Xho I restriksiyon enzimi kullanılarak RFLP analizi uygulanmıştır. Sonuçlar incelendiğinde, 54 örneğin 38'inin (%70.37) A, 16'sının ise (%29.63) B genotipine ait olduğu belirlenmiştir. Kadın hasta sayısının B genotipinde anlamlı düzeyde daha fazla olduğu (p=0.18), ayrıca hastalarda birlikte bulunan karın ağrısı ve ishal yakınması ile G. lamblia B genotipi arasında istatistiksel olarak anlamlı bir ilişki olduğu tespit edilmiştir (ki-kare testi, 10.52; P<0.05). Hastaların yaşı ya da yakınmaları ile G. lamblia genotipleri...

show abstract

Türk Yağlı Kuyruklu Koyun Irklarındaki Beta-Laktoglobulin Gen Tipleri

Cited by 2 publications

References 8 publications

Investigation of Genetic Polymorphisms of CSN1S1 and BLG Genes in Norduz sheep by PCR-RFLP method

Investigation of Genetic Polymorphisms of CSN1S1 and BLG Genes in Norduz sheep by PCR-RFLP method

Bir Türk Hasta Kohortunda Giardia lamblia Genotiplendirilmesi: Semptomlar ile Genotipler Arası İlişkinin Araştırılması

Contact Info

Product

Resources

About