Tumour and host cell PD-L1 is required to mediate suppression of anti-tumour immunity in mice

Abstract

Expression of PD-L1, the ligand for T-cell inhibitory receptor PD-1, is one key immunosuppressive mechanism by which cancer avoids eradication by the immune system. Therapeutic use of blocking antibodies to PD-L1 or its receptor PD-1 has produced unparalleled, durable clinical responses, with highest likelihood of response seen in patients whose tumour or immune cells express PD-L1 before therapy. The significance of PD-L1 expression in each cell type has emerged as a central and controversial unknown in the clinical development of immunotherapeutics. Using genetic deletion in preclinical mouse models, here we show that PD-L1 from disparate cellular sources, including tumour cells, myeloid or other immune cells can similarly modulate the degree of cytotoxic T-cell function and activity in the tumour microenvironment. PD-L1 expression in both the host and tumour compartment contribute to immune suppression in a non-redundant fashion, suggesting that both sources could be predictive of sensitivity to therapeutic agents targeting the PD-L1/PD-1 axis.

Adipose PD-L1 Modulates PD-1/PD-L1 Checkpoint Blockade Immunotherapy Efficacy in Breast Cancer

“…The cDNA was cloned through the AgeI and MluI sites in the pINDUCER11 vector containing a constitutive EGFP expression cassette and a tetracycline response element as previously described. 52 For construction of the pGL3- Cd274 promoter and pmirGLO- Cd274 3’UTR vectors, the following primers were used to amplify the 1kb promoter and 500 bp 3’UTR sequence of Cd274 gene, respectively: Cd274 promoter-F: GCGACGCGTGTTTCATTATGTCGAGGAACTTTGA; Cd274 promoter-R: ACGCGTCGACCTGGTCTTATCTCGAGTTCAGAGCC; Cd274 3’UTR-F: CCGCTCGAGGAAGGAGCCCATTAGCTCTGTGT; Cd274 3’UTR-R: ACGCGTCGACAATAAATAAAAATATTTATTAAATTAATGC. Amplified promoter sequence was inserted into pGL3 vector through the SalI and MluI sites.…”

“…PD-L1 knockdown by siRNA oligonucleotides in post-differentiated adipocytes was as previously described, 52 using Lipofectamine reagent RNAiMAX (Invitrogen). Control siOTP (ON-TARGETplus Non-Targeting Pool, Cat: #D-001810–10) and siPD-L1 (SMARTpool: ON-TARGETplus Cd274 siRNA, Cat: #M-040760) were purchased from Dharmacon, Inc (USA).…”

“…2,4 More recent studies show that PD-L1 expressed in host immune cells including myeloid cells also contribute to suppression of antitumor immunity and immunotherapy. 5–7 Anti-PD-L1 and anti-PD-1 antibody immunotherapies block the immune-suppressive actions of PD-L1/PD-1 to mediate durable responses and have become standard of care for multiple cancer types. 8–14 However, these antitumor immunotherapies are only effective for a subset of cancer patients and are not usually curative.…”

PD-L1 on host cells is essential for PD-L1 blockade–mediated tumor regression

“…Recently, the importance of PD-L1 on tumor versus host cells during tumor growth has been intensively debated (24)(25)(26)(27). In one study, the role of PD-L1 during tumor formation was studied (25). It is suggested that both hostand tumor-PD-L1 contribute to immune suppression during the establishment of tumors (25).…”

“…However, the essential or sufficient role of PD-L1 on tumor versus nontumor cells for immune evasion is still unclear (1,22,23). Recently, the importance of PD-L1 on tumor versus host cells during tumor growth has been intensively debated (24)(25)(26)(27). In one study, the role of PD-L1 during tumor formation was studied (25).…”