Tumor Suppressor Cylindromatosis (CYLD) Controls HIV Transcription in an NF-κB-Dependent Manner

Abstract

Characterizing the cellular factors that play a role in the HIV replication cycle is fundamental to fully understanding mechanisms of viral replication and pathogenesis. Whole-genome small interfering RNA (siRNA) screens have identified positive and negative regulators of HIV replication, providing starting points for investigating new cellular factors. We report here that silencing of the deubiquitinase cylindromatosis protein (CYLD), increases HIV infection by enhancing HIV long terminal repeat (LTR)-driven transcription via the NF-B pathway. CYLD is highly expressed in CD4؉ T lymphocytes, monocyte-derived macrophages, and dendritic cells. We found that CYLD silencing increases HIV replication in T cell lines. We confirmed the positive role of CYLD silencing in HIV infection in primary human CD4 ؉ T cells, in which CYLD protein was partially processed upon activation. Lastly, Jurkat T cells latently infected with HIV (JLat cells) were more responsive to phorbol 12-myristate 13-acetate (PMA) reactivation in the absence of CYLD, indicating that CYLD activity could play a role in HIV reactivation from latency. In summary, we show that CYLD acts as a potent negative regulator of HIV mRNA expression by specifically inhibiting NF-Bdriven transcription. These findings suggest a function for this protein in modulating productive viral replication as well as in viral reactivation. IMPORTANCEHIV transcription is regulated by a number of host cell factors. Here we report that silencing of the lysine 63 deubiquitinase CYLD increases HIV transcription in an NF-B-dependent manner. We show that CYLD is expressed in HIV target cells and that its silencing increases HIV infection in transformed T cell lines as well as primary CD4 ؉ T cells. Similarly, reactivation of latent provirus was facilitated in the absence of CYLD. These data suggest that CYLD, which is highly expressed in CD4 ؉ T cells, can control HIV transcription in productive infection as well as during reactivation from latency.

BIRC2/cIAP1 Is a Negative Regulator of HIV-1 Transcription and Can Be Targeted by Smac Mimetics to Promote Reversal of Viral Latency

“…Results from this analysis led to the identification of 139 host factors that, when depleted, enhanced viral infection by 50% or more compared to the negative control with at least two independent siRNAs (Figure 1B; see Table S1 available online). Proteins involved in cell cycle regulation, ubiquitination, apoptosis, and DNA replication were found to be enriched in the set of 139 genes (Figure 1C), including CYLD, a gene we recently reported to regulate LTR-dependent transcription (Manganaro et al, 2014). …”

CYLD-Mediated Signaling and Diseases

“…CYLD is best known as a major negative regulator of this pathway. There are several excellent reviews that detail the involvement of CYLD with NF-kB activation, including an extensive review by Chen on NF-kB and IKK [46, 72, 73]. After initial details of the negative regulation of NF-kB by CYLD emerged, it was found that TRAF3, TRAF5 and TRAF6 do not interact with CYLD but a TRAF-interacting protein (TRIP) does [7, 12].…”

Expression of HERV-K108 envelope interferes with HIV-1 production

“…Expression was normalized by Ribosomal Protein S11 ( RPS11 ) expression using primers: Rps11 Fw GCCGAGACTATCTGCACTAC and Rps11 Rv ATGTCCAGCC TCAGAACTTC [36]. qPCR conditions were: 95°C for 10 min, followed by 40 cycles of 95°C for 10 s and 60°C for 60 s. Expression levels for individual RNAs were calculated based on their threshold cycle ( C T ) (ΔΔ C T values).…”