Tumor antigen-loaded AAV vaccine drives protective immunity in a melanoma animal model

Krotova, Karina; Kuoch, Hisae; Caine, Colin; Aslanidi, George

doi:10.1016/j.omtm.2023.01.006

Cited by 10 publications

(4 citation statements)

References 55 publications

(83 reference statements)

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The choice of AAV serotype as a tool for gene delivery or gene editing depends on the tropism for desired target tissues as well as the ability to generate sufficiently high-quality titers. AAV6-based vectors became commonly used for targeting lymphoid cells [48][49][50], myeloid cells [42,[50][51][52], hematopoietic stem cells [53,54], muscular cells [55][56][57], cardiomyocytes [58][59][60], pulmonary cells [44,61] and others.…”

Section: Discussionmentioning

confidence: 99%

Bioengineered Hybrid Rep 2/6 Gene Improves Encapsulation of a Single-Stranded Expression Cassette into AAV6 Vectors

Tejero,

Duzenli,

Caine

et al. 2023

Genes

Self Cite

View full text Add to dashboard Cite

The production of clinical-grade recombinant adeno-associated viral (AAV) vectors for gene therapy trials remains a major hurdle in the further advancement of the gene therapy field. During the past decades, AAV research has been predominantly focused on the development of new capsid modifications, vector-associated immunogenicity, and the scale-up vector production. However, limited studies have examined the possibility to manipulate non-structural components of AAV such as the Rep genes. Historically, naturally isolated, or recombinant library-derived AAV capsids have been produced using the AAV serotype 2 Rep gene to package ITR2-flanked vector genomes. In the current study, we mutated four variable amino acids in the conservative part of the binding domain in AAV serotype 6 Rep to generate a Rep2/6 hybrid gene. This newly generated Rep2/6 hybrid had improved packaging ability over wild-type Rep6. AAV vectors produced with Rep2/6 exhibited similar in vivo activity as standard AAV6 vectors. Furthermore, we show that this Rep2/6 hybrid also improves full/empty capsid ratios, suggesting that Rep bioengineering can be used to improve the ratio of fully encapsulated AAV vectors during upstream manufacturing processes.

show abstract

Section: Discussionmentioning

confidence: 99%

Bioengineered Hybrid Rep 2/6 Gene Improves Encapsulation of a Single-Stranded Expression Cassette into AAV6 Vectors

Tejero,

Duzenli,

Caine

et al. 2023

Genes

Self Cite

View full text Add to dashboard Cite

show abstract

“…Both AAV9 and AAV-DJ vectors were packaged in a single-strain expression cassette with chicken β-actin (CBA) promoter-driven fusion of firefly luciferase (Luc), and yellow fluorescent protein (YFP) (24,25). Recombinant AAV vectors were produced using the triple transfection method and purified as described previously (26,27). Briefly, HEK293 cells were co-transfected with three plasmids encoding 1) Rep/Cap, 2) ITRs-CBA- fLuc-YFP , and 3) Ad helper genes using polyethyleneimine (#23966-1, Polysciences, USA).…”

Section: Methodsmentioning

confidence: 99%

“…Subsequently, the viral DNA was cleaned using DNA Clean & Concentrator TM 25 (#11-305C, Genesee Scientific, USA). Vector titers were quantified by qPCR with a TBGreen ® Advantage (#S4748, Takara Bio, USA), using the following primer pair specific to the CBA promoter region within the viral cassette: forward primer 5’-TCCCATAGTAACGCCAATAGG -3’ and reverse primer 5’- CTTGGCATATGATACACTTGATG -3’(26,27).…”

Section: Methodsmentioning

confidence: 99%

AAV-DJ is Superior to AAV9 for Targeting Brain and Spinal Cord, and De-Targeting Liver Across Multiple Delivery Routes in Mice

Chauhan,

Daugherty,

Khadir

et al. 2024

Preprint

Self Cite

View full text Add to dashboard Cite

Highly efficient adeno associated viruses (AAVs) targeting the central nervous system (CNS) are needed to deliver safe and effective therapies for inherited neurological disorders. The goal of this study was to compare the organ-specific transduction efficiencies of two AAV capsids across three different delivery routes. We compared AAV9-CBA-fLucYFP to AAV-DJ-CBA-fLucYFP using the following delivery routes in mice: intracerebroventricular (ICV) 1x1012 vg/kg, intrathecal (IT) 1x1012 vg/kg, and intravenous (IV) 1x1013 vg/kg body weight. Our evaluations revealed that following ICV and IT administrations, AAV-DJ demonstrated significantly increased vector genome (vg) uptake throughout the CNS as compared to AAV9. Through the IV route, AAV9 demonstrated significantly increased vg uptake in the CNS. However, significantly fewer vgs were detected in the off-target organs (kidney and liver) following administration of AAV-DJ using the IT and IV delivery routes as compared to AAV9. Distributions of vgs correlate well with transgene transcript levels, luciferase enzyme activities, and immunofluorescence detection of YFP. Overall, between the two vectors, AAV-DJ resulted in better targeting and expression in CNS tissues paired with de-targeting and reduced expression in liver and kidneys. Our findings support further examination of AAV-DJ as a gene therapy capsid for the treatment of neurological disorders.

show abstract

“…[97][98][99] Viral gene delivery vectors have many advantages and have been extensively explored for cancer gene delivery, but their immunogenicity and high toxicity limit their clinical application. [100,101] Besides, viral vectors generally face problems of large-scale vector manufacturing and cost, for example, Glybera is priced at 1 million euros per patient. [102] Compared with viral vectors, nonviral vectors (e.g., lipids, polymers, dendrimer, polypeptide, and inorganic structures, etc.)…”

Section: Gene Therapymentioning

confidence: 99%

Polyphenol‐Based Nanosystems for Next‐Generation Cancer Therapy: Multifunctionality, Design, and Challenges

Feng,

Chen,

Fan

et al. 2023

Macromolecular Bioscience

View full text Add to dashboard Cite

With the continuous updating of cancer treatment methods and the rapid development of precision medicine in recent years, there are higher demands for advanced and versatile drug delivery systems. Scientists are committed to create greener and more effective nanomedicines where the carrier is no longer limited to a single function of drug delivery. Polyphenols, which can act as both active ingredients and fundamental building blocks, are being explored as potential multifunctional carriers that are efficient and safe for design purposes. Due to their intrinsic anticancer activity, phenolic compounds have shown surprising expressiveness in ablation of tumor cells, overcoming cancer multidrug resistance (MDR), and enhancing immunotherapeutic efficacy. This review provides an overview of recent advances in the design, synthesis, and application of versatile polyphenol‐based nanosystems for cancer therapy in various modes. Moreover, the merits of polyphenols and the challenges for their clinical translation are also discussed, and it is pointed out that the novel polyphenol delivery system requires further optimization and validation.

show abstract

Tumor antigen-loaded AAV vaccine drives protective immunity in a melanoma animal model

Cited by 10 publications

References 55 publications

Bioengineered Hybrid Rep 2/6 Gene Improves Encapsulation of a Single-Stranded Expression Cassette into AAV6 Vectors

Bioengineered Hybrid Rep 2/6 Gene Improves Encapsulation of a Single-Stranded Expression Cassette into AAV6 Vectors

AAV-DJ is Superior to AAV9 for Targeting Brain and Spinal Cord, and De-Targeting Liver Across Multiple Delivery Routes in Mice

Polyphenol‐Based Nanosystems for Next‐Generation Cancer Therapy: Multifunctionality, Design, and Challenges

Contact Info

Product

Resources

About