Truncated fragments in polymerase chain reaction-based DNA sequencing

Westberg, Joakim; Holmberg, Anders; Uhlén, Mathias; Pettersson, Bertil

doi:10.1002/(sici)1522-2683(19990301)20:3<502::aid-elps502>3.0.co;2-6

Cited by 11 publications

(8 citation statements)

References 32 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…1B) was obtained. Correct orientation and nucleotide sequence of the introduced linkers in the plasmids pGEM-T-EB200, pUC19-EB200 and pUC19L-EB200 were verified with solid phase DNA sequencing using dye-labelled terminators [31]. The Sanger fragments were analyzed on an A.L.F.…”

Section: Methodsmentioning

confidence: 99%

Comparative Immunization Study Using RNA and DNA Constructs Encoding a Part of the Plasmodium falciparum Antigen Pf332

et al. 2001

View full text Add to dashboard Cite

Development of nucleic acid-based vaccines against parasitic diseases shows great promise, although certain concerns about safety aspects of conventional DNA vaccines have been raised. This study presents a comparison of antibody responses induced in mice by DNA and RNA-based immunization with vectors encoding a part of the P. falciparum antigen Pf332. Two types of plasmids were used, one conventional DNA plasmid containing a cytomegalovirus promoter and one suicidal DNA plasmid encoding the Semliki Forest virus (SFV) replicase. RNA, encoding the SFV replicase and the relevant antigen, was delivered either as naked RNA or packaged in SFV suicide particles. In general, the antibody responses induced by the DNA plasmids were low and peaking after three injections, the conventional plasmid giving the highest responses. Also the RNA delivered in SFV particles consistently induced antibody responses, although comparatively low. Analyses of the ratio of immunoglobulin (Ig)G1/IgG2a subclasses in the responses indicated that all plasmids resulted in a bias for a Th2-type of response, while the SFV-particles elicited a Th1 type of response. Importantly, all these immunogens induced an immunological memory, which could be efficiently activated by a booster injection with the corresponding protein, with unchanged patterns of IgG subclasses.

show abstract

Section: Methodsmentioning

confidence: 99%

Comparative Immunization Study Using RNA and DNA Constructs Encoding a Part of the Plasmodium falciparum Antigen Pf332

et al. 2001

View full text Add to dashboard Cite

show abstract

“…The plasmids pSFV3 [11] and pSFV3‐sp [19], the latter furnished with a signal peptide MDRAKL 10 PQAQA preceding the multiple cloning site, was Bam HI‐digested and a synthetic T4 polynucleotide kinase‐phosphorylated (Fermentas AB, Vilnius, Lithuania) oligonucleotide linker was introduced (5′‐GATCCGAATGCGGATGCATCTATCGAT‐3′, with the complementary sequence 5′‐GATCATCGATAGATGCATCCGCATTCG‐3′) containing the recognition sequences for the restriction enzymes Bsm I, Nsi I and Cla I. Correct orientation and nucleotide sequence of the introduced linker in the resulting plasmids, pSFV3‐l and pSFV3‐spl, was verified with solid‐phase DNA sequencing and dye‐labelled terminators [20]. The Sanger fragments were analysed on an A.L.F.…”

Section: Methodsmentioning

confidence: 99%

Mammalian cell production of a respiratory syncytial virus (RSV) candidate vaccine recovered using a product‐specific affinity column

Andersson

Hansson

Power

et al. 2001

Biotech and App Biochem

View full text Add to dashboard Cite

The recombinant production of a respiratory syncytial virus (RSV) candidate vaccine BBG2Na in baby hamster kidney cells (BHK-21 cells) was investigated. BBG2Na consists of a serum-albumin-binding region (BB) fused to a 101-amino-acid fragment of the RSV G-protein. Semliki Forest virus-based expression vectors encoding both intracellular and secreted forms of BBG2Na were constructed and found to be functional. Affinity recovery of BBG2Na employing human serum albumin columns was found to be inefficient due to the abundance of BSA in the applied samples. Instead, a strategy using a tailor-made affinity ligand based on a combinatorially engineered Staphylococcus aureus protein A domain, showing specific binding to the G-protein part of the product, was evaluated. In conclusion, a strategy for production and successful recovery of BBG2Na in mammalian cells was created, through the development of a product-specific affinity column.

show abstract

“…The vector pUC19 [27] was restricted with Eco RI and Hin dIII and a synthetic oligonucleotide linker (5′‐AATTCGAGCTCGAATGCGAATGTGAAGCTTGG CGCGCC‐3′, with complementary sequence) was introduced by ligation. The nucleotide sequence of the linker region of the resulting plasmid, pUC19L, now containing the recognition sequences for the enzymes Sac I, Bsm I, Hin dIII and Asc I, was verified with solid phase DNA sequencing and dye‐labelled terminators [28]. The Sanger fragments were analysed on an ALF express™ DNA sequencer (Amersham Pharmacia Biotech, Uppsala, Sweden).…”

Section: Methodsmentioning

confidence: 99%

Protection against respiratory syncytial virus (RSV) elicited in mice by plasmid DNA immunisation encoding a secreted RSV G protein-derived antigen

Andersson¹,

Liljeström²,

Ståhl³

et al. 2000

FEMS Immunology &Amp; Medical Microbiology

View full text Add to dashboard Cite

Plasmid vectors encoding two different variants, one cytoplasmic and one secreted version, of a candidate vaccine BBG2Na to respiratory syncytial virus (RSV), were constructed and evaluated in a nucleic acid vaccination study. The two different vectors, which employed the Semliki Forest virus gene amplification system, were found to express BBG2Na appropriately in in vitro cell cultures. Immunisation of mice with the plasmid vectors elicited significant serum anti-BBG2Na IgG responses only in the mice receiving the plasmid encoding the secreted version of BBG2Na. Consistent with antibody induction data, sterilising lung protection against RSV-A challenge was also only observed in this group. These results indicate that the targeting of antigen expression (intracellular versus secreted) would be an important factor to consider in the design of nucleic acid vaccines.

show abstract

Truncated fragments in polymerase chain reaction-based DNA sequencing

Cited by 11 publications

References 32 publications

Comparative Immunization Study Using RNA and DNA Constructs Encoding a Part of the Plasmodium falciparum Antigen Pf332

Comparative Immunization Study Using RNA and DNA Constructs Encoding a Part of the Plasmodium falciparum Antigen Pf332

Mammalian cell production of a respiratory syncytial virus (RSV) candidate vaccine recovered using a product‐specific affinity column

Protection against respiratory syncytial virus (RSV) elicited in mice by plasmid DNA immunisation encoding a secreted RSV G protein-derived antigen

Contact Info

Product

Resources

About