Truncated forms of the PA protein containing only the C-terminal domains are associated with the ribonucleoprotein complex within H1N1 influenza virus particles

Abstract

We have examined the expression profile of the influenza virus PA protein in pH1N1/2009 virus-infected cells. Immunoblotting analysis of virus-infected MDCK cells revealed the presence of full-length PA protein from 8 hrs post-infection, together with the simultaneous appearance of PA protein species of approximately 50 kDa, 35/39 kDa and 20/25 kDa (collectively referred to as PA*). PA* was also detected in H1N1/WSN virus-infected cells indicating that its presence was not virus-specific, and PA* was also observed in virus-infected A549 and CEF cells indicating that its presence was not cell type-specific. PA* was detected in cells expressing the recombinant PA protein, indicating that the PA* formation occurred in the absence of virus infection. These data collectivity indicated that PA* formation is an intrinsic property of PA gene expression. The association of PA* with purified influenza virus particles was demonstrated by immunoblotting, and a protease protection assay provided evidence that PA* was packaged into virus particles. The ribonucleoprotein (RNP) complex was isolated from purified influenza virus particles using glycerol gradient centrifugation, which demonstrated that PA* was associated with the RNP complex. To the best of our knowledge this is the first report to demonstrate that PA protein species containing only segments of the C-terminal domain form during influenza virus infection. Furthermore, these truncated PA protein species are subsequently packaged into virus particles as part of the functional RNP complex.

Impaired Nuclear Export of the Ribonucleoprotein Complex and Virus-Induced Cytotoxicity Combine to Restrict Propagation of the A/Duck/Malaysia/02/2001 (H9N2) Virus in Human Airway Cells

“…We have previously demonstrated that the H1N1/WSN NP and the polymerase proteins are efficiently expressed in MDCK cells. The NP was detected at between 2 and 4 hpi, while the polymerase proteins were detected at between 4 and 6 hpi [34]. The appearance of these proteins was concomitant with efficient nuclear export of the H1N1/WSN virus NP at between 4 and 6 hpi [33].…”

“…The anti-PA (mab9F5), and anti-PB2 (mab4G3) mouse monoclonal antibodies and the mouse anti-PB1 polyclonal antibody have been described previously [34]. The anti-NP (Chemicon, San Diago, CA, USA), anti-NEP and anti-M1 (ThermoFisher Scientific, Waltham, MA, USA), anti-actin and anti-FLAG (Sigma Aldrich, St louis, MO, USA), anti-lamin A/C and anti-lamin B1 (Santa Cruz, Dallas, Tx, USA), anti-Nuclear Pore Complex (NPC) (Abcam, Cambridge, UK) were purchased.…”

“…The siPA-H1N1 (5 -GCAAUUGAGGAGUGCCUGA3 ) [37], siNP and siGFP (5 GGCUACGUCCAGGAGCGCAUU3 ) were purchased from Dhamacon (Lafayette, CO, USA). siRNAs experiments were performed using a 100 nM siRNA concentration in Lipofectamine 2000 as described previously [34]. Transfections were optimized using the siGlo probe Dhamacon (Lafayette, CO, USA).…”

“…Three siRNA molecules were used in this analysis; siGFP which targeted the green fluorescent protein (GFP) mRNA (a negative control), and siNP and siPA that targeted the H1N1/WSN NP and PA mRNA respectively [37,43]. Using the siGlo probe we estimated that approximately 85% transfection efficiencies were routinely attained in MDCK cells, and that siPA treatment routinely lead to an approximate 90% reduction in PA protein expression levels [34].…”