Triptolide inhibits extracellular matrix protein synthesis by suppressing the Smad2 but not the MAPK pathway in TGF- 1-stimulated NRK-49F cells

Zhu, Bin; Wang, Yongjun; Zhu, Caifeng; Lin, Yi; Zhu, Xiaonian; Wei, Sheng; Lü, Ying; Cheng, Xinqi

doi:10.1093/ndt/gfq239

Cited by 26 publications

(27 citation statements)

References 63 publications

Supporting

Mentioning

Contrasting

Unclassified

Order By: Relevance

“…9 Triptolide was also reported to activate ERK 1/2 and p38 MAPK. 10 Our experimental results showed that the p38 MAPK inhibitor (SB203580) and the ERK1/2 inhibitor (U0126) suppressed the upregulation of IL-37 induced by triptolide and triptonide, respectively. However, this study is only a preliminary exploration, and further investigation is required to address the mechanism of IL-37 upregulation induced by triptolide and triptonide.…”

mentioning

confidence: 67%

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Liang

Zhao

et al. 2014

Cell Mol Immunol

View full text Add to dashboard Cite

IL-37 is an anti-inflammatory cytokine that was only recently identified, and it is highly expressed in tissues from patients with inflammatory and autoimmune diseases. Inflammatory cytokines and inflammatory stimuli can induce the upregulation of IL-37. However, it has not been reported whether anti-inflammatory medications induce the expression of IL-37. In this work, we uncovered, for the first time, that two main bioactive components, triptolide and triptonide, from the herb Tripterygium wilfordii Hook f. (TwHF), which possess anti-inflammatory activity, upregulate the expression of IL-37, and this expression was suppressed by ERK1/2 and p38 MAPK inhibitors. Overall, our research demonstrated, for the first time, that anti-inflammatory active components (triptolide and triptonide) upregulated the expression of IL-37 most likely via activation of the ERK1/2 and p38 MAPK pathways. Keywords: IL-37; THP-1 cells; Tripterygium wilfordii Hook F.; triptolide; triptonide IL-37 is a newly defined member of the IL-1 cytokine family, which is a fundamental inhibitor of innate immunity. 1 IL-37 mRNA and protein have been detected in inflammatory and autoimmune diseases such as rheumatoid arthritis, 1 atopic dermatitis, 2 inflammatory bowel disease 3 and systemic lupus erythematosus. 4 IL-37 is endogenously kept at low levels in human cells, and can be upregulated by pro-inflammatory cytokines and inflammation stimuli. 1 However, it is still unclear whether anti-inflammatory medications induce the expression of IL-37. We document here, for the first time, that IL-37 was upregulated in THP-1 cells induced by two active components, triptolide and triptonide, extracted from the herb Tripterygium wilfordii Hook F (TwHF).In this study, THP-1-derived macrophages were used as a model system. 5 THP-1 cells were treated with five active monomer components (triptolide, triptonide, triptophenolide, celastrol and wilforlide A (Beijing Medicass Biotechnol, Beijing, China)) with purity of more than 98% at different concentrations (1, 5, 10 and 20 ng/ml) for various incubation periods (1, 6, 12 and 18 h). The expression of IL-37 mRNA was analyzed by real-time quantitative PCR using SYBR Premix Ex Taq kit (TaKaRa, Dalian, China) on the ABI prism 7700 Sequence Detection System (Perkin Elmer, Foster City, CA, USA). The sequences of the primers were as follows: IL-37-F (TTAGAAGACCCGGCTGGAAGCC) and IL-37-R (AGATCT-CTGGGCGTATGTAGT); GAPDH-F (ACCCAGAAGACTGT-GGATGG) and GAPDH-R (TTCTAGACGGCAGGTCAGGT). The expression of the target gene is presented as a ratio, which was normalized to the endogenous reference gene glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and the comparative CT method was used as reported in the literature. 6 The chemical structure of triptolide and triptonide are shown in Figure 1a. The results showed that triptolide and triptonide upregulated the expression of IL-37 mRNA (Figure 1b and c). As shown in Figure 1b, triptolide at concentrations of 5, 10 and 20 ng/ml was found to upregulate IL-37 mRNA, and the maximum upregu...

show abstract

mentioning

confidence: 67%

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Liang

Zhao

et al. 2014

Cell Mol Immunol

View full text Add to dashboard Cite

show abstract

“…In this study, emodin was found to suppress TGF-β1-induced ERK1/2 and p38 phosphorylation, but not JNK activation, suggesting that it may suppress fibronectin and collagen III expression by inhibiting these two signaling pathways activated by TGF-β1. Our previous study demonstrated that there was no crosstalk between the ERK1/2 and p38 pathways (17). Therefore, emodin may suppress TGF-β1-induced ECM expression by inhibiting ERK1/2 and P38 phosphorylation in NRK-49F cells.…”

Section: Discussionmentioning

confidence: 92%

“…TGF-β1 is the most important cytokine stimulating renal fibrosis. We have previously demonstrated that TGF-β1 activated the ERK1/2, p38 and JNK pathways in NRK-49F cells (17). In the present study, the suppression of p38 and ERK1/2 signaling by their specific inhibitors significantly suppressed TGF-β1-induced fibronectin and collagen III secretion, but JNK inhibition did not significantly alter ECM expression, suggesting that TGF-β1 promotes ECM synthesis by activating the ERK1/2 and p38 pathways, but not the JNK pathway.…”

Section: Discussionmentioning

confidence: 94%

“…Our previous study indicated that there is no crosstalk between ERK1/2, p38 and JNK in TGF-β1-stimulated NRK-49F cells (17). Here, we blocked each of these three MAPK pathways using their specific inhibitor to investigate the role of MAPK in ECM synthesis.…”

Section: Emodin Significantly Inhibited Ecm Synthesis In Tgf-β1-stimumentioning

confidence: 92%

“…Our previous study demonstrated that TGF-β1 activates ERK1/2, p38 and JNK in NRK-49F cells (17). Here, the effects of emodin on the phosphorylation of MAPK were investigated using Western blotting.…”

Section: Emodin Inhibited the Phosphorylation Of Erk1/2 And P38mentioning

confidence: 96%

See 2 more Smart Citations

Emodin inhibits extracellular matrix synthesis by suppressing p38 and ERK1/2 pathways in TGF-β1-stimulated NRK-49F cells

et al. 2011

View full text Add to dashboard Cite

Abstract. emodin has been demonstrated to inhibit the fibrotic process in chronic renal disease, but its mechanisms have yet to be fully elucidated. This study was carried out to investigate the effects of emodin on extracellular matrix (ecM) synthesis in TGF-β1-stimulated NRK-49F cells. NRK-49F cells stimulated with TGF-β1 were incubated with various concentrations of emodin. ECM proteins, including collagen type III and fibronectin, were detected using ELISA. ERK1/2, p38 and JNK phosphorylation were measured by Western blotting. p38, ERK1/2 and JNK were respectively inhibited with the specific inhibitors SB203580, PD98059 and SP600125. Emodin slightly inhibited the expression of fibronectin and collagen type III in NRK-49F cells without TGF-β1 treatment, and significantly suppressed fibronectin and collagen type III secretion in TGF-β1-stimulated NRK-49F cells. ERK1/2 and p38 specific inhibitors, but not JNK inhibitor, suppressed the TGF-β1-induced expression of fibronectin and collagen type III. Our previous study demonstrated that there was no crosstalk between ERK1/2, p38 and JNK signals in TGF-β1-stimulated NRK-49F cells. Here, we found that emodin inhibited the phosphorylation of ERK1/2 and p38 significantly, but did not suppress the phosphorylation of JNK. In summary, emodin suppresses fibronectin and collagen type III expression via the inhibition of ERK1/2 and p38 phosphorylation in TGF-β1-stimulated NRK-49F cells.

show abstract

Gremlin aggravates hyperglycemia‐induced podocyte injury by a TGFβ/smad dependent signaling pathway

Liu

et al. 2013

J of Cellular Biochemistry

View full text Add to dashboard Cite

Gremlin is a bone morphogenic protein (BMP) antagonist and is elevated in diabetic kidney tissues. In the early course of diabetic nephropathy (DN), podocyte are injured. We studied the protein and gene expression of gremlin in mice podocytes cultured in hyperglycemia ambient. The role of gremlin on podocyte injury and the likely signaling pathways involved were determined. Expression of gremlin was visualized by confocal microscopy. Recombinant mouse gremlin and small interfering RNA (siRNA) targeting to gremlin1 identified the role played by gremlin on podocytes. Study of canonical (smad2/3) and non-canonical (p38MAPK and JNK1/2) transforming growth factor beta (TGFβ)/smad mediated signaling revealed the putative signaling mechanisms involved. Smad2/3 siRNA and TGFβ receptor inhibition (SB431542) were used to probe canonical TGFβ/smad signaling in gremlin-induced podocyte injury. Apoptosis of podocytes was measured by TUNEL assay. Gremlin expression was enhanced in high glucose cultured mouse podocytes, and was localized predominantly in the cytoplasm and negligibly on the cell membrane. Not only expression of nephrin and synaptopodin were decreased on treatment with gremlin, but also synaptopodin rearrangement and nephrin relocalization were evident. Knockdown gremlin1 or smad2/3 by siRNA, and inhibition of TGFβR (SB431542) attenuated podocyte injury. Inhibition of canonical TGF-β signal blocked the injury of gremlin on podocytes. In conclusion, gremlin was clearly elevated in high glucose cultured mouse podocytes, and likely employed endogenous canonical TGFβ1/Smad signaling to induce podocyte injury. Knockdown gremlin1 by siRNA may be clinically useful in the attenuation of podocyte injury.

show abstract

Triptolide inhibits extracellular matrix protein synthesis by suppressing the Smad2 but not the MAPK pathway in TGF- 1-stimulated NRK-49F cells

Abstract: The effect of triptolide to suppress ECM synthesis by inhibiting Smad2 activation may surpass its stimulating effect on ECM synthesis by activation of p38 and ERK 1/2, leading to a total inhibition of ECM synthesis in TGF-β1-stimulated NRK-49F cells.

Cited by 26 publications

References 63 publications

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Modulation of IL-37 expression by triptolide and triptonide in THP-1 cells

Emodin inhibits extracellular matrix synthesis by suppressing p38 and ERK1/2 pathways in TGF-β1-stimulated NRK-49F cells

Gremlin aggravates hyperglycemia‐induced podocyte injury by a TGFβ/smad dependent signaling pathway

Contact Info

Product

Resources

About