Triple‐Color Super‐Resolution Imaging of Live Cells: Resolving Submicroscopic Receptor Organization in the Plasma Membrane

Abstract

In living color: efficient intracellular covalent labeling of proteins with a photoswitchable dye using the HaloTag for dSTORM super-resolution imaging in live cells is described. The dynamics of cellular nanostructures at the plasma membrane were monitored with a time resolution of a few seconds. In combination with dual-color FPALM imaging, submicroscopic receptor organization within the context of the membrane skeleton was resolved.

Interplay between phosphorylation and palmitoylation mediates plasma membrane targeting and sorting of GAP43

“…To construct a GAP43-HaloTag fusion, restriction sites for Eco RI and Eco RV were added using primers cagatccgctgatatcatgctgtgctgtatgag and gcagaattcaagcttatgttcttgg. The resulting PCR product was sequentially cut with the respective enzymes (Fermentas) and cloned into pSems-Halo-1-26m (Wilmes et al ., 2012). To construct pPAGFP-F, we used pEGFP-F (Clontech/Takara, Shiga, Japan), which contains the 20–amino acid farnesylation signal from c-Ha-Ras fused to the C-terminus of enhanced GFP (EGFP), and exchanged the EGFP part against PAGFP from pPAGFP(A206K)×1-C1.…”

Optical control and study of biological processes at the single-cell level in a live organism

“…Nonetheless, despite the above-mentioned difficulties and challenges, many successful demonstrations of SR imaging in live cells have been reported[58–78]. Impressively, several examples of SR imaging in living organisms have also been recently reported.…”

Super-Resolution Molecular and Functional Imaging of Nanoscale Architectures in Life and Materials Science

“…Fluorophores targeting specific intracellular components such as DNA (Flors et al, 2009; Benke and Manley, 2012) and membranes (Shim et al, 2012) have also been used for SR fluorescence imaging. Hybrid systems of genetic tagging and external fluorophores, such as SNAP-tag, TMP-tag, CLIP-tag, and Halo-tag, provide an alternative tool for specific labeling of the target (Hein et al, 2010; Lee et al, 2010; Wombacher et al, 2010; Wilmes et al, 2012; Stagge et al, 2013). Using these systems, a wide variety of external fluorophores can be attached to the non-fluorescent genetic tags, enabling the use of specific fluorophores, which possess the particular fluorescent properties required for an imaging experiments.…”