Transposition of the maize <i>Ds</i> element from a viral vector to the rice genome

Sugimoto, Kazuhiko; Otsuki, Yoshiaki; Saji, Shoko; Hirochika, Hirohiko

doi:10.1046/j.1365-313x.1994.5060863.x

Cited by 38 publications

(20 citation statements)

References 29 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…Oc cell line (11) derived from the indica variety C5924 of 0. sativa was cultured in Muller-Grafe's AA medium (12). Protoplast formation and transformation of rice by electroporation were carried out as described (13).…”

Section: Methodsmentioning

confidence: 99%

Retrotransposons of rice involved in mutations induced by tissue culture.

Hirochika

Sugimoto

Otsuki

et al. 1996

Proc. Natl. Acad. Sci. U.S.A.

689

560

View full text Add to dashboard Cite

Five retrotransposon families of rice (TosiTos5) have been reported previously. Here we report 15 new retrotransposon families of rice (Tos6-Tos2O). In contrast to yeast and Drosophila retrotransposons, all ofthe rice retrotransposons examined appear inactive (or almost inactive) under normal growth conditions. Three of the rice retrotransposons (ToslO, Tosl7, and Tosl9) are activated under tissue culture conditions. The most active one, Tosi 7, was studied in detail. The copy number of Tosl7 increased with prolonged culture period.

show abstract

Section: Methodsmentioning

confidence: 99%

Retrotransposons of rice involved in mutations induced by tissue culture.

Hirochika

Sugimoto

Otsuki

et al. 1996

Proc. Natl. Acad. Sci. U.S.A.

689

560

View full text Add to dashboard Cite

show abstract

“…Total DNAs were prepared and their concentration was determined as described by Hirochika (1993). Blotting, preparation of probes, and hybridization were as described previously (Hirochika et al, 1992;Sugimoto et al, 1994). ScaI (nucleotide [nt] 566)-XhoI (end of the cDNA) of NtMYB2 cDNA was used as a NtMYB2-specific probe.…”

Section: Dna and Rna Gel Blot Analysismentioning

confidence: 99%

MYB-Related Transcription Factor NtMYB2 Induced by Wounding and Elicitors is a Regulator of the Tobacco Retrotransposon Tto1 and Defense-Related Genes

2000

Self Cite

View full text Add to dashboard Cite

Transposition of the tobacco retrotransposon Tto1 is regulated mainly by transcription from the long terminal repeat (LTR). Functional analysis of the LTR showed that the 13-bp motif is a cis -regulatory element involved in activation by tissue culture, wounding, and treatment with elicitors. The 13-bp motif contains a conserved motif (L box) that has been implicated in the expression of phenylpropanoid synthetic genes in response to defense-related stresses. To gain further insight into the regulatory mechanism of the retrotransposon and defense-related genes, cDNAs encoding four different proteins binding to the 13-bp motif have been isolated and characterized. One protein is identical to the previously reported NtMYB1, the RNA for which is induced by virus infection; the others are also MYB-related factors. One of these factors, NtMYB2, was analyzed in detail. NtMYB2 mRNA was induced by wounding and by treatment with elicitors. NtMYB2 activated expression from the promoter with the 13-bp motif and from the promoter of the phenylalanine ammonia lyase gene ( Pv-PAL2 ) in tobacco protoplasts. Overexpression of NtMYB2 cDNA in transgenic tobacco plants induced expression of Tto1 and a PAL gene. Together, these results indicate that NtMYB2 is involved in the stress response of the retrotransposon and defense-related genes. INTRODUCTIONRetrotransposons (or class I elements) are widely distributed in eukaryotic genomes. Differing from DNA-type transposable elements (or class II elements) such as Activator/ Dissociation ( Ac/Ds ), Suppressor-Mutator ( Spm-Mu ) , and Mu elements of maize and Tam elements of snapdragon (Coen et al., 1989; Fedoroff, 1989), retrotransposons transpose through an RNA intermediate. By reverse transcription, DNA copies are synthesized and reinserted into the genome. Retrotransposons are classified into two groups: long terminal repeat (LTR) retrotransposons and non-LTR retrotransposons. Studies have revealed that LTR retrotransposons are major components of the plant genome (Pearce et al., 1996;SanMiguel et al., 1996;Bennetzen et al., 1998). Retrotransposons have contributed significantly to the remarkable variations in genome size and may also have contributed to genomic evolution by changing the structures and expression patterns of genes (White et al., 1994).For understanding the process of the genome and gene evolution, elucidation of the mechanisms of regulation of retrotransposons is crucial. In plants, diverse sequences of retrotransposons have been found in Ͼ 100 species (Flavell et al., 1992;Voytas et al., 1992; Hirochika and Hirochika, 1993).Despite this wide and abundant distribution in plants, most of retrotransposons are presumed to be inactive because of their defective structures. Only Tnt1 and Tto1 of tobacco and Tos17 of rice have been demonstrated to be active (Grandbastien et al., 1989;Pouteau et al., 1991; Hirochika, 1993; Hirochika et al., 1996a). Both transposition and transcription of these retrotransposons are inactive under normal conditions. Under stress conditions...

show abstract

“…DNA from the mutants was extracted using the CTAB method [20][21][22][23][24][25]. Ten-microgram aliquots of DNA were first digested with Hae III and then electrophoresed onto a 0.8% 18 agarose gel.…”

Section: Genomic Dna Extraction Pcr Southern and Rt-pcr Analysismentioning

confidence: 99%

“…Targetsite sequences were amplified using the rice total DNA, respectively, as described [24] except that the total DNA was digested with Hae III. Two sets of primers were used for the two-step PCR: adaptor primer-1, GCGTAATAC-GACTCACTATAGCAATTAACC and Tos l7 primer-1, TGCTCTCCACTATGTGCCCTCCGAGCTA were used for the first PCR; the adaptor primer-2, GACTCACTA-TAGCAATTAAC and Tos 17 primer-2, ACAAGTCG-CTGATTTCTTCAC were used for the second reaction.…”

Section: Amplification Of Sequences Flanking Transposed Tos L7mentioning

confidence: 99%