Transmission of Integrated Human Herpesvirus 6 through Stem Cell Transplantation: Implications for Laboratory Diagnosis

Clark, Duncan A.; Nacheva, Elisabeth P.; Leong, Hoe Nam; Brazma, Diana; Li, Ying Ting; Tsao, Edward H.; Buyck, Hubertus; Atkinson, Claire; Lawson, Heather M.; Potter, Michael; Griffiths, Paul

doi:10.1086/500838

Cited by 151 publications

(133 citation statements)

References 15 publications

Supporting

Mentioning

125

Contrasting

Unclassified

Order By: Relevance

“…In fact, it seems that cases of chromosomal HHV-6 integration are usually inherited in the germ line and passed from parent to child (10,37). Other notable features of viral chromosomal integration are the presence not only of variant B but sometimes variant A instead (8,11,37,46) and persistent high-level HHV-6 DNA in whole blood and serum (46), which in the latter case, is at least 100-fold higher than that observed briefly in primary infection (47).…”

Section: Discussionmentioning

confidence: 99%

“…Amplification primers were U67F, 5Ј-GGCTAGAACGTATTTG CTGCAGA-3Ј, and U67R, 5Ј-AATGTACGTCCCCGAAATGG-3Ј, and the TaqMan probe was U67P, 5Ј-(FAM)CGTTTCGCGGACTCAAGATCAACAA GTT(TAMRA)-3Ј. A 73-bp sequence of the U67 open reading frame was amplified (8). The lower limit of detection was 5 copies/reaction mixture.…”

Section: Patients (I) Group 1 Routine Diagnosis Patientsmentioning

confidence: 99%

“…In the absence of primary infection, the key finding linking HHV-6 to these cases was the detection of viral DNA in cerebrospinal fluid (CSF) by PCR, leading to the assumption that HHV-6 was replicating in the central nervous system (CNS). However, this interpretation has been questioned in view of the phenomenon of HHV-6 chromosomal integration (8,46). HHV-6 is the only human herpesvirus found integrated into host chromosomes (10,37,38).…”

mentioning

confidence: 99%

“…HHV-6 is the only human herpesvirus found integrated into host chromosomes (10,37,38). The occasional individual with such integration is easily identifiable, since every leukocyte inevitably contains viral sequences and there are thus characteristically persistent high levels of HHV-6 DNA in both serum and whole blood (8,46). Since normal CSF, i.e., in the absence of inflammation, contains a few leukocytes, it is only to be expected that, in cases of HHV-6 integration, viral DNA will be present in CSF even though there is no viral replication.…”

mentioning

confidence: 99%

“…In this context, it is also important to differ-entiate HHV-6 variant A (HHV-6A) from HHV-6 variant B (HHV-6B), as either virus may be chromosomally integrated (8,46) but only HHV-6B is found in primary infection in young children (14). We now report on the prevalence and concentration of HHV-6A and B DNA in the CSF of immunocompetent patients with suspected encephalitis and compare the findings for primary infection with those for viral chromosomal integration.…”

mentioning

confidence: 99%

See 4 more Smart Citations

Human Herpesvirus 6 DNA Levels in Cerebrospinal Fluid Due to Primary Infection Differ from Those Due to Chromosomal Viral Integration and Have Implications for Diagnosis of Encephalitis

et al. 2007

View full text Add to dashboard Cite

The prevalence and concentration of human herpesvirus 6 (HHV-6) DNA in the cerebrospinal fluid (CSF) of the immunocompetent in primary infection was compared with that in viral chromosomal integration. Samples from 510 individuals with suspected encephalitis, 200 young children and 310 older children and/or adults, and 12 other patients were tested. HHV-6 DNA concentration (log 10 copies/ml) was measured in CSF, serum, and whole blood using PCR. Serum HHV-6 immunoglobulin G antibody was measured by indirect immunofluorescence. Primary infection was defined by antibody seroconversion and/or a low concentration of HHV-6 DNA (<3.0 log 10 copies/ml) in a seronegative serum. Chromosomal integration was defined by a high concentration of viral DNA in serum (>3.5 log 10 copies/ml) or whole blood (>6.0 log 10 copies/ml). The prevalences of CSF HHV-6 DNA in primary infection and chromosomal integration were 2.5% and 2.0%, respectively, in the young children (<2 years) and 0% and 1.3%, respectively, in the older children and/or adults. The mean concentration of CSF HHV-6 DNA in 9 children with primary infection (2.4 log 10 copies/ml) was significantly lower than that of 21 patients with viral chromosomal integration (4.0 log 10 copies/ml). Only HHV-6B DNA was found in primary infection, whereas in viral integration, 4 patients had HHV-6A and 17 patients HHV-6B. Apart from primary infection, chromosomal integration is the most likely cause of HHV-6 DNA in the CSF of the immunocompetent. Our results show that any diagnosis of HHV-6 encephalitis or other type of active central nervous system infection should not be made without first excluding chromosomal HHV-6 integration by measuring DNA load in CSF, serum, and/or whole blood.

show abstract

Section: Discussionmentioning

confidence: 99%

Section: Patients (I) Group 1 Routine Diagnosis Patientsmentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

mentioning

confidence: 99%

See 3 more Smart Citations

Human Herpesvirus 6 DNA Levels in Cerebrospinal Fluid Due to Primary Infection Differ from Those Due to Chromosomal Viral Integration and Have Implications for Diagnosis of Encephalitis

et al. 2007

View full text Add to dashboard Cite

show abstract

Human Herpesviruses‐6 and ‐7 ( HHV ‐6A, HHV ‐6B and HHV ‐7)

Ward

2013

Encyclopedia of Life Sciences

View full text Add to dashboard Cite

Infection with human herpesviruses‐6 and ‐7 (HHV‐6/7) is universal in human populations. Early studies did not distinguish between the two virus species, HHV‐6A and HHV‐6B. No disease has been causally linked to HHV‐6A, but HHV‐6B and HHV‐7 are established as a cause of febrile illness in early childhood that is sometimes accompanied by fits. HHV‐6B can also cause encephalitis after haematopoietic stem cell transplant. Chromosomally integrated HHV‐6 (either A or B) is a condition in which the complete viral genome is present in every nucleated cell in the body; it occurs in a minority of people and is vertically transmitted. Lack of recognition of this phenomenon has led to the misdiagnosis of active infection and inappropriate use of antiviral therapy. An important unresolved question is whether integrated virus is a cause of disease. Key Concepts: The term HHV‐6 covers two herpesvirus species, HHV‐6A and HHV‐6B. HHV‐6A is not known to cause any disease. HHV‐6B primary infection may cause fever, rash and febrile fits. HHV‐6B reactivation may cause encephalitis in haematopoietic stem cell transplant recipients. HHV‐7 primary infection may cause fever, rash and febrile fits. Chromosomal integration of HHV‐6 (CIHHV‐6) involves either HHV‐6A or HHV‐6B and is always telomeric. CIHHV‐6 occurs in approximately 1% of the human population and is vertically transmitted. A lack of understanding of the phenomenon of CIHHV‐6 has led to misdiagnosis of disease and inappropriate antiviral treatment. Whether or not CIHHV‐6 can reactivate in vivo and cause disease is currently unknown.

show abstract