Transmembrane phosphoprotein Cbp senses cell adhesion signaling mediated by Src family kinase in lipid rafts

The role of membrane microdomains in transmembrane signaling through the epithelial glycoprotein Gp140/CDCP1

“…For instance, active SFKs phosphorylate C-terminal src kinase (CSK) binding protein (Cbp), a protein that resides in DRMs. Phosphorylation of Cbp then recruits CSK which phosphorylates SFK at Y527 and results in SFK inactivation, and knockdowns of Cbp or CSK impaired cell spreading after adhesion [16]. These results establish that integrin-mediated adhesion regulates GM1 and DRMs at the cell membrane.…”

“…Both PKCδ and SFK activity have been implicated in signaling cascades that modify cell-substrate adhesion via integrins [13,16,37]. In keratinocytes, activated PKCδ is important to phosphorylate the integrin α6 and β4 subunits, and PKCδ-but not PKCα-over-expression in primary keratinocytes reduced the ability of those keratinocytes to adhere to laminin 5 in an adhesion assay [37].…”

Overexpression of Csk-binding protein contributes to renal cell carcinogenesis

“…Silencing of Cbp by small interfering RNA Two siRNAs targeting position 269-289 (GGGACAUUCUUU CAGAGGACA; named Cbp-Ri-3) and position 1174-1194 (AAGCGAUACAGACUCUCAACA; named Cbp-Ri-5; Shima et al, 2003;Tauzin et al, 2008) of human Cbp mRNA were selected. The scrambled siRNA of Cbp-Ri-3 (3-neg) (CUAUAG GAUGAUCUGGCGAAC) was used as a negative control.…”

“…SFKs phosphorylate multiple tyrosines of human Cbp including tyrosine 317, which recruits Csk, a negative regulator of SFKs, from the cytosol into lipid rafts where SFKs are localized, resulting in the inhibition of SFKs activation (Brdicka et al, 2000;Kawabuchi et al, 2000). This negative regulatory mechanism has been found in several systems, including T-cell activation, cell adhesion, spreading processes and growth factor signaling (Kawabuchi et al, 2000;Torgersen et al, 2001;Davidson et al, 2003;Shima et al, 2003;Matsuoka et al, 2004;Zhang et al, 2004). Besides recruiting Csk, Cbp also regulates SFKs activation by interacting directly with SFKs, such as Fyn and Lyn (Ingley et al, 2006;Davidson et al, 2007;Solheim et al, 2008).…”

Csk-binding protein (Cbp) negatively regulates epidermal growth factor-induced cell transformation by controlling Src activation

“…We choose the mouse Cbp sequence from positions 1160-1180 (5 0 -AAGCCATACAGACTCTAAACA-3 0 ) as the target for RNA interference (RNAi) because its effectiveness has been proved in publication (Shima et al, 2003). The corresponding human Cbp sequence from positions 1163-1183 (5 0 -AAGC GATACAGACTCTCAACA-3 0 ), which has two different nucleotides, was used as a control for the specificity of RNAi.…”