Translation of intronless RNAs is strongly stimulated by the Epstein–Barr virus mRNA export factor EB2

Abstract

The Epstein–Barr virus protein (EB2) allows the nuclear export of a particular subset of early and late viral RNAs derived from intronless genes. EB2 is conserved among most herpesvirus members and its presence is essential for the production of infectious particles. Here we show that, besides its role as a nuclear export factor, EB2 strongly stimulates translation of unspliced mRNAs without affecting overall cellular translation. Interestingly, this effect can be reversed by the addition of an intron within the gene. The spliced mRNA is then efficiently exported and translated even in the absence of EB2. Moreover, we show that EB2 associates with translating ribosomes and increases the proportion of its target RNA in the polyribosomal fraction. Finally, testing of EB2 homolog proteins derived from EBV-related herpesviruses, shows that, even if they play similar roles within the replication cycle of their respective virus, their mechanisms of action are different.

Human cytomegalovirus UL69 protein facilitates translation by associating with the mRNA cap-binding complex and excluding 4EBP1

“…4B) after infection with wild-type virus, as compared to infection with a pUL69-deficient mutant. As yet, we do not know whether pUL69 affects translation globally or if it enhances translation of a subset of genes, as reported for pUL69 homologs encoded by HSV (21-23) and Epstein-Barr virus (27).…”

“…27 and references therein) regulate the export of mRNA from the nucleus and stimulate translation. These similarities raise the possibility that ICP27, EB2, and other members of this pan-herpesvirus protein family also prevent 4EBP1 from associating with the m 7 G-cap-binding complex.…”

Staufen1 senses overall transcript secondary structure to regulate translation

“…Obtained cDNAs were then used as input for quantitative PCR analysis as described in ref. 48 with the following primers: GAPDH forward, 5′ tccaccaccctgttgctgtag 3′ and reverse, 5′ acccactcctccacctttgac3′; Arf1 forward, 5′ atcttcgcctcccgactc 3′ and reverse, 5′ atgcttgtggacaggtgga3′; C11orf58 forward, 5′ cagacgacgatctgggatct 3′ and reverse, 5′ tgatctcctataacaagacgaccag 3′; PAICS forward, 5′ aaggaaaagctgcaatctcaa 3′ and reverse, 5′ ccccacattttctggtgaag 3′; MDM2 forward, 5′ catgcctgcccactttaga 3′ and reverse, 5′ ggaggctcccaactgctt 3′; MDM4 forward, 5′ agggatgaaatgcttcttgg 3′ and reverse, 5′ aaggttgctatgaggtctaccttg 3′.…”

The 3′ Untranslated Region of the Andes Hantavirus Small mRNA Functionally Replaces the Poly(A) Tail and Stimulates Cap-Dependent Translation Initiation from the Viral mRNA

“…Upon transfection (5 h), total RNA and total proteins were extracted (41) and used to quantify recombinant RNA by a reverse transcription quantitative PCR approach (RTqPCR) and FLuc activity, respectively. The virus-like RNAs were amplified in parallel with the GAPDH (glyceraldehyde-3-phosphate dehydrogenase) housekeeping gene, as previously described (41). As shown in Fig.…”