Transitive and Systemic RNA Silencing: Both Involving an RNA Amplification Mechanism?

Bleys, Annick; Houdt, Helena Van; Depicker, Anna

doi:10.1007/978-3-540-28130-6_6

Cited by 5 publications

(6 citation statements)

References 80 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…According to the current model for transitive silencing in Arabidopsis, transcripts that are targeted by trigger-derived siRNAs can in some way be recognized by RDR6 as templates for the production of dsRNA (Vaistij et al, 2002;Himber et al, 2003; for review, see Bleys et al, 2006b). These new dsRNAs are subsequently processed into secondary siRNAs that can target homologous transcripts without sequence identity to the initial silencing inducer.…”

Section: Discussionmentioning

confidence: 99%

The Frequency and Efficiency of Endogene Suppression by Transitive Silencing Signals Is Influenced by the Length of Sequence Homology

et al. 2006

Self Cite

View full text Add to dashboard Cite

Transitivity, the spread of RNA silencing along primary target sequences, leads to the degradation of secondary targets that have no sequence homology to the initial silencing trigger. We demonstrate that increasing the distance between direct and adjacent target sequences in a transgenic primary target delays the onset of silencing of a secondary target gene. Silencing can spread in a 3# to 5# direction over a distance of at least 500 nucleotides (nt), but this requires consistently more time compared to a distance of 98 nt or 250 nt. The efficiency and frequency of transitive silencing of an endogene depends on the length of its sequence homology with the primary target. With a length of 500 nt, efficient silencing can eventually be established in all plants, whereas lengths of 250 nt and 98 nt homology result in less efficient and less frequent suppression. These results suggest that amplification of secondary small interfering RNAs (siRNAs) is a time-requiring process that gradually expands the population of siRNAs until a steady-state level is reached. Moreover, the length of the sequence homology in the primary target providing secondary siRNAs determines whether this steady-state level readily exceeds the threshold necessary for efficient silencing.

show abstract

Section: Discussionmentioning

confidence: 99%

The Frequency and Efficiency of Endogene Suppression by Transitive Silencing Signals Is Influenced by the Length of Sequence Homology

et al. 2006

Self Cite

View full text Add to dashboard Cite

show abstract

“…To amplify the I4CAT2 fragment with a total length of 164 bp (containing the 82‐bp‐long intron 4), the forward primer 5′‐CCGGTTAATTAACAGCAGGCGGAGTTGGATAC‐3′ was combined with the reverse primer 5′‐CCGGTTAATTAACACAGGGACGAGGAGGTACT‐3′. The PCR fragments and the construct Y 7 (P35S_GUS_nptII3′chs; Bleys et al. , 2006b) were digested with Pac I, after which the PCR fragments were ligated into the Y 7 construct.…”

Section: Methodsmentioning

confidence: 99%

Introns reduce transitivity proportionally to their length, suggesting that silencing spreads along the pre-mRNA

2010

View full text Add to dashboard Cite

SUMMARYEndogenes rarely support transitive silencing, whereas most transgenes generally allow the spread of silencing to occur along the primary target. To determine whether the presence of introns might explain the difference, we investigated the influence of introns in the primary target on 3¢-5¢ silencing transitivity. When present in a transgene, an intron-containing endogene fragment does not prohibit the spread of silencing across this fragment, indicating that introns do not preclude silencing transitivity along endogenes. Also, a multiple intron-containing genomic gene fragment that had previously been shown not to support transitivity in an endogenous context could support transitivity when present in a transgene. Nevertheless, genomic intron-containing fragments delayed the onset and diminished the efficiency of transitive silencing of a secondary target compared with the corresponding cDNA fragments. Remarkably, transitivity was impaired proportionally with the length of the pre-mRNA, and not of the mRNA. The latter result suggests that the RNAdependent RNA polymerase-based spreading of silencing progresses along the non-spliced rather than the fully processed mature mRNA.

show abstract

“…Therefore, spreading of silencing of endogenes has to rely on the spreading of the original silencing signal produced in the cells containing the silencing inducer. Evidence of the inability of RDR to function with endogenous sequences comes from two sources, from transitivity studies (reviewed in Bleys et al, 2005) and from rdr mutants (Himber et al, 2003; Schwach et al, 2005). The phenomenon of silencing spreading along the mRNA sequence is termed transitive RNA silencing and is characteristic of plants and the nematode C. elegans (Sijen et al, 2001; Vaistij et al, 2002; Van Houdt et al, 2003).…”

Section: Short‐range Spreadmentioning

confidence: 99%

RNA silencing movement in plants

Kalantidis

Schumacher

Alexiadis

et al. 2008

Biology of the Cell

126

View full text Add to dashboard Cite

Higher eukaryotes have developed a mechanism of sequence-specific RNA degradation which is known as RNA silencing. In plants and some animals, similar to the nematode Caenorhabditis elegans, RNA silencing is a non-cellautonomous event. Hence, silencing initiation in one or a few cells leads progressively to the sequence-specific suppression of homologous sequences in neighbouring cells in an RNA-mediated fashion. Spreading of silencing in plants occurs through plasmodesmata and results from a cell-to-cell movement of a short-range silencing signal, most probably 21-nt siRNAs (short interfering RNAs) that are produced by one of the plant Dicer enzymes. In addition, silencing spreads systemically through the phloem system of the plants, which also translocates metabolites from source to sink tissues. Unlike the short-range silencing signal, there is little known about the mediators of systemic silencing. Recent studies have revealed various and sometimes surprising genetic elements of the short-range silencing spread pathway, elucidating several aspects of the processes involved. In this review we attempt to clarify commonalities and differences between the individual silencing pathways of RNA silencing spread in plants. IntroductionHigher eukaryotes have developed a mechanism of sequence-specific RNA degradation called 'RNA silencing', an idiom that combines the terms PTGS (post-transcriptional gene silencing) and RNAi (RNA interference). The central part of the RNA degradation pathway is the generation of siRNAs (short interfering RNAs) from dsRNA (double-stranded RNA) by an RNase III-type nuclease, Dicer. The siRNAs are incorporated into the RISC (RNAinduced silencing complex), and, after strand separation, the remaining single-stranded RNA guides the sequence-specific cleavage of a target RNA. Despite common features of RNA silencing, there are differences between the animal and plant kingdoms and also between species (reviewed in Meister and Tuschl,

show abstract

Transitive and Systemic RNA Silencing: Both Involving an RNA Amplification Mechanism?

Cited by 5 publications

References 80 publications

The Frequency and Efficiency of Endogene Suppression by Transitive Silencing Signals Is Influenced by the Length of Sequence Homology

The Frequency and Efficiency of Endogene Suppression by Transitive Silencing Signals Is Influenced by the Length of Sequence Homology

Introns reduce transitivity proportionally to their length, suggesting that silencing spreads along the pre-mRNA

RNA silencing movement in plants

Contact Info

Product

Resources

About