Transient Retrovirus-Based CRISPR/Cas9 All-in-One Particles for Efficient, Targeted Gene Knockout

Abstract

The recently discovered CRISPR/Cas9 system is widely used in basic research and is a useful tool for disease modeling and gene editing therapies. However, long-term expression of DNA-modifying enzymes can be associated with cytotoxicity and is particularly unwanted in clinical gene editing strategies. Because current transient expression methods may still suffer from cytotoxicity and/or low efficiency, we developed non-integrating retrovirus-based CRISPR/Cas9 all-in-one particles for targeted gene knockout. By redirecting the gammaretroviral packaging machinery, we transiently delivered Streptococcus pyogenes Cas9 (SpCas9) mRNA and single-guide RNA transcripts into various (including primary) cell types. Spatiotemporal co-delivery of CRISPR/Cas9 components resulted in efficient disruption of a surrogate reporter gene, as well as functional knockout of endogenous human genes CXCR4 and TP53. Although acting in a hit-and-run fashion, knockout efficiencies of our transient particles corresponded to 52%–80% of those obtained from constitutively active integrating vectors. Stable SpCas9 overexpression at high doses in murine NIH3T3 cells caused a substantial G0/G1 arrest accompanied by reduced cell growth and metabolic activity, which was prevented by transient SpCas9 transfer. In summary, the non-integrating retrovirus-based vector particles introduced here allow efficient and dose-controlled delivery of CRISPR/Cas9 components into target cells.

Bacteriophage MS2 displays unreported capsid variability assembling T = 4 and mixed capsids

“…Current viral vectors already have packaging limitations which place severe restrictions on their use (Ran et al, 2015) and thus the small size of the MS2 genome (Fiers et al, 1970) may have precluded further investigation. Therefore, our work, along with previous work that has described the use of MS2-chimeric retrovirus-like particles to overcome this obstacle (Li et al, 2014;Knopp et al, 2018) and evidence of large cargos being incorporated into MS2 in the past (Zhan et al, 2009;Zhang et al, 2015), makes engineering MS2 an attractive prospect for future research.…”

Synthetic Notch-Receptor-Mediated Transmission of a Transient Signal into Permanent Information via CRISPR/Cas9-Based Genome Editing

“…The investigated SynNotch receptors were originally designed by the lab of Wendell A. Lim [3] and obtained via Addgene (Watertown, MA, USA). The lentiviral vector constructs pHR_SFFV_LaG17_synNotch_TetRVP64 (Addgene Plasmid #79128), pHR_PGK_antiCD19_synNotch_Gal4VP64 (Addgene Plasmid #79125), pHR_PGK_antiHer24D5-3_synNotch_Gal4VP64 (Addgene Plasmid #85422), pHR_PGK_antiHer24D5-5_synNotch_Gal4VP64 (Addgene Plasmid #85423), and pHR_EGFPligand Addgene Plasmid #79129) were used to generate infectious lentiviral particles using a third-generation self-inactivating lentiviral backbone (pRRL.PPT.SFFV.pre) [13]. This backbone was also modified to generate the response elements, where either five copies of the Gal4 DNA binding domain (DBD) binding motive (GGAGCACTGTCCTCCGAACG) or six copies of the tetracycline response element (TCCCTATCAGTGATAGAGA) were cloned 5 to a minimal cytomegalovirus (CMV) promoter.…”

“…The bulk population was sorted using the α-myc Tag antibody (Cell signaling #2233; 9B11) and expanded. In a next step, these cells were transduced with lentiviral vector particles for the following constructs; positive control (CXCR4 gRNA under control of U6 promoter and an SFFV-driven hspCas9_T2A_PAC), negative control (scrambled gRNA under control of U6 promoter and an SFFV-driven hspCas9_T2A_PAC), and experimental construct (CXCR4 gRNA under control of U6 promoter and a tTA-VP64 inducible CMV min -driven hspCas9_T2A_PAC) [13].…”

CRISPR/Cas9-mediated gene knockout in human adipose stem/progenitor cells

“…We quantitatively assess SPRY1 KO efficiency on gDNA using a mutation detection assay and TIDE analysis followed by a comparison to corresponding effects on mRNA and protein levels and functionality. CRISPR/Cas9 efficacy is a critical issue dependent on the target gene, cell type and way of delivery [17,30]. Genome editing was so far mainly done in immortalized or transformed cell lines [31] and an overall efficiency up to ~80% has been reported [17].…”