Transient Kinetics, Fluorescence, and FRET in Studies of Initiation of Translation in Bacteria

Milón, Pohl; Konevega, Andrey L.; Peske, Frank; Fabbretti, Attilio; Gualerzi, Claudio O.; Rodnina, Marina V.

doi:10.1016/s0076-6879(07)30001-3

Cited by 125 publications

(174 citation statements)

References 73 publications

Supporting

Mentioning

170

Contrasting

Unclassified

Order By: Relevance

“…(IF1, IF2, IF3), and fMet-tRNA fMet were prepared as described [47][48][49] . E. coli SelA and SelD (gift from M. Wahl, Free University of Berlin) and SelB 50 containing a hexahistidine tag (gift from A. Böck, LMU Munich) were expressed in BL21(DE3) cells and purified according to published protocols 4,51 .…”

Section: Discussionmentioning

confidence: 99%

The pathway to GTPase activation of elongation factor SelB on the ribosome

Fischer

Neumann

Bock

et al. 2016

Nature

Self Cite

103

137

View full text Add to dashboard Cite

Section: Discussionmentioning

confidence: 99%

The pathway to GTPase activation of elongation factor SelB on the ribosome

Fischer

Neumann

Bock

et al. 2016

Nature

Self Cite

103

137

View full text Add to dashboard Cite

“…To obtain kirromycin-stalled E. coli ribosome-EF-Tu complexes, ribosomes from E. coli MRE 600, initiation factors (IF1, IF2, IF3), fMettRNA fMet , EF-Tu and Phe-tRNA Phe were prepared as described [31][32][33] . Prior to initiation, the mRNA (GGCAAGGAGGUAAAUAAUGUUCGUUACGAC; the AUG start codon coding for fMet and UUC coding for Phe are underlined) was incubated with 0.1 mM EDTA for 90 s at 80 uC and shock cooled in an ice-water bath.…”

Section: Methodsmentioning

confidence: 99%

Structure of the E. coli ribosome–EF-Tu complex at <3 Å resolution by Cs-corrected cryo-EM

Fischer

Neumann

Konevega

et al. 2015

Nature

Self Cite

359

443

View full text Add to dashboard Cite

Single particle electron cryomicroscopy (cryo-EM) has recently made significant progress in high-resolution structure determination of macromolecular complexes due to improvements in electron microscopic instrumentation and computational image analysis. However, cryo-EM structures can be highly non-uniform in local resolution 1,2 and all structures available to date have been limited to resolutions above 3 Å 3,4 . Here we present the cryo-EM structure of the 70S ribosome from Escherichia coli in complex with elongation factor Tu, aminoacyl-tRNA and the antibiotic kirromycin at 2.65-2.9 Å resolution using spherical aberration (C s )-corrected cryo-EM. Overall, the cryo-EM reconstruction at 2.9 Å resolution is comparable to the best-resolved X-ray structure of the E. coli 70S ribosome 5 (2.8 Å ), but provides more detailed information (2.65 Å ) at the functionally important ribosomal core. The cryo-EM map elucidates for the first time the structure of all 35 rRNA modifications in the bacterial ribosome, explaining their roles in fine-tuning ribosome structure and function and modulating the action of antibiotics. We also obtained atomic models for flexible parts of the ribosome such as ribosomal proteins L9 and L31. The refined cryo-EM-based model presents the currently most complete high-resolution structure of the E. coli ribosome, which demonstrates the power of cryo-EM in structure determination of large and dynamic macromolecular complexes.Determining the structure of large, dynamic biological macromolecules at a uniformly high resolution provides a challenge both for X-ray crystallography and cryo-EM. Here we have used aberration-corrected cryo-EM in combination with extensive computational sorting to solve *These authors contributed equally to this work.

show abstract

“…Biochemicals were from Merck, nucleotide triphosphates from Jena Bioscience. The following oligonucleotides were used in the experiment of [30][31][32] . Site-directed mutagenesis of the WT gene 60 construct 9 was performed using the Quickchange PCR protocol with the appropriate oligonucleotide primers (Supplementary Table 1).…”

Section: Methodsmentioning

confidence: 99%

High-efficiency translational bypassing of non-coding nucleotides specified by mRNA structure and nascent peptide

et al. 2014

Self Cite

View full text Add to dashboard Cite

The gene product 60 (gp60) of bacteriophage T4 is synthesized as a single polypeptide chain from a discontinuous reading frame as a result of bypassing of a non-coding mRNA region of 50 nucleotides by the ribosome. To identify the minimum set of signals required for bypassing, we recapitulated efficient translational bypassing in an in vitro reconstituted translation system from Escherichia coli. We find that the signals, which promote efficient and accurate bypassing, are specified by the gene 60 mRNA sequence. Systematic analysis of the mRNA suggests unexpected contributions of sequences upstream and downstream of the non-coding gap region as well as of the nascent peptide. During bypassing, ribosomes glide forward on the mRNA track in a processive way. Gliding may have a role not only for gp60 synthesis, but also during regular mRNA translation for reading frame selection during initiation or tRNA translocation during elongation.

show abstract

Transient Kinetics, Fluorescence, and FRET in Studies of Initiation of Translation in Bacteria

Cited by 125 publications

References 73 publications

The pathway to GTPase activation of elongation factor SelB on the ribosome

The pathway to GTPase activation of elongation factor SelB on the ribosome

Structure of the E. coli ribosome–EF-Tu complex at <3 Å resolution by Cs-corrected cryo-EM

High-efficiency translational bypassing of non-coding nucleotides specified by mRNA structure and nascent peptide

Contact Info

Product

Resources

About