Transcriptome Responses of Wild Arachis to UV-C Exposure Reveal Genes Involved in General Plant Defense and Priming

Abstract

Stress priming is an important strategy for enhancing plant defense capacity to deal with environmental challenges and involves reprogrammed transcriptional responses. Although ultraviolet (UV) light exposure is a widely adopted approach to elicit stress memory and tolerance in plants, the molecular mechanisms underlying UV-mediated plant priming tolerance are not fully understood. Here, we investigated the changes in the global transcriptome profile of wild Arachis stenosperma leaves in response to UV-C exposure. A total of 5751 differentially expressed genes (DEGs) were identified, with the majority associated with cell signaling, protein dynamics, hormonal and transcriptional regulation, and secondary metabolic pathways. The expression profiles of DEGs known as indicators of priming state, such as transcription factors, transcriptional regulators and protein kinases, were further characterized. A meta-analysis, followed by qRT-PCR validation, identified 18 metaDEGs as being commonly regulated in response to UV and other primary stresses. These genes are involved in secondary metabolism, basal immunity, cell wall structure and integrity, and may constitute important players in the general defense processes and establishment of a priming state in A. stenosperma. Our findings contribute to a better understanding of transcriptional dynamics involved in wild Arachis adaptation to stressful conditions of their natural habitats.

Crop Wild Relatives: A Valuable Source of Tolerance to Various Abiotic Stresses

“…Transcriptomic analyses on the wild and highly adaptable A. glabrata revealed a plethora of transcript factors to be expressed under drought, salt, and cold stress implementation [ 52 ]. Finally, a great number (4513) of differentiated expressed genes (DEGs) was also recorded to be expressed under UV exposure and dehydration in A. stenosperma by Martins et al [ 57 ], mainly associated with cell signaling, protein dynamics, hormonal and transcriptional regulation, and secondary metabolic pathways. These genomic findings provide useful tools for the further improvement of the species in abiotic stresses.…”

The Stilbene Synthase Family in Arachis: A Genome-Wide Study and Functional Characterization in Response to Stress

“…The expression patterns of the 20 genes encoding for STS and five for CHS in A. stenosperma were analyzed using our previous transcriptome surveys to investigate their transcriptional dynamics in response to biotic and abiotic stresses. The wild A. stenosperma was chosen for this expression analysis as it is a high-resveratrol producer, is adapted to marginal habitats, harbors stress-resilience traits, and is highly responsive to multiple environmental stimuli [36]. Transcriptome data were obtained from A. stenosperma plants submitted to different types of stresses: UV exposure; drought treatments in moderate (dry-down) and severe (dehydration) conditions; nematode infection (at 3, 6, 7, and 9 days after infection; DAI); and combined drought imposition and nematode infection (cross-stress).…”

“…The expression profiles of A. stenosperma STS genes were subjected to heatmap construction by TBtools-II software 2.0 [67] using our previously produced transcriptome RNA-Seq data from plants submitted to different types of stresses: M. arenaria infection (at 3, 6, 7 and 9 DAI); UV exposure; moderate (dry-down) and severe (dehydration) drought treatments; and combined drought and nematode stresses (cross-stress) [36,63,69,70].…”

“…qRT-PCR analysis of AsSTS4 expression in peanut hairy roots was evaluated using specific primer pairs (5 -3 ) STS1 (AAGGCCATCAAGGAATGGGG/ATGGGTCGAGGCCTAAGAGT) [36]. Total RNA was extracted from hairy roots in biological triplicates using the RNeasy Plant Mini kit (Qiagen, Hilden, Germany) following the manufacturer's instructions.…”