Transcriptional regulation of α-fetoprotein expression by dexamethasone in human hepatoma cells

Nakabayashi, Hidekazu; Watanabe, Ken; Saito, Asako; Otsuru, Akira; Sawadaishi, Kazuyuki; Tamaoki, Taiki

doi:10.1016/s0021-9258(17)31253-x

Cited by 73 publications

(9 citation statements)

References 34 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…AFP has been studied for many years since the entire AFP sequence was cloned in 1983. AFP transcription is mainly controlled by its promoter, enhancer, and silencer in the 5′ region [28,29]. The silencer was reported to show extremely low activity in fetal mouse livers but Fig.…”

Section: Discussionmentioning

confidence: 99%

Icaritin promotes apoptosis and inhibits proliferation by down-regulating AFP gene expression in hepatocellular carcinoma

Liu

Xue

et al. 2021

BMC Cancer

View full text Add to dashboard Cite

Background Icaritin, an active ingredient of the Chinese herb Epimedium, plays an anti-tumor role in liver cancer by inhibiting the proliferation of hepatocellular cells and promoting their apoptosis. In China, phase II and a large phase III clinical trial of icaritin reagent for the treatment of hepatocellular cancer is under-going, but the specific mechanism of icaritin action was unclear. Alpha-fetoprotein (AFP), an oncofetal protein, produced in the healthy fetal liver and yolk sac. Intracellular AFP promoted cellular proliferation and inhibited cellular apoptosis in hepatocellular carcinoma (HCC). The study was aimed to investigate the effect of icaritin on HCC through p53/AFP pathway. Methods Real-time RT PCR and western blot were used to detect p53 and AFP expression levels in HCC cells treated with icaritin. The mechanism of icaritin affecting p53 expression was verified by ubiquitination experiment, and the binding activity of icaritin on p53 in AFP promoter region was verified by luciferase experiment. EdU, MTT and flow cytometry were used to determine whether icaritin affected HCC cellular proliferation and apoptosis through p53/ AFP pathway. Expression levels of p53 and AFP in xenograft mouse model were determined by western blotting. Results Our results showed icaritin inhibited AFP expression at mRNA and protein level. AFP was also identified as the target gene of the p53 transcription factor. Icaritin abrogated murine double minute (Mdm) 2-mediated p53 ubiquitination degradation to improve the stability of p53. Up-regulated p53 protein levels then transcriptionally inhibited the AFP promoter. Icaritin-mediated decrease of AFP through Mdm2/p53 pathways inhibited HCC cellular proliferation and promoted HCC cellular apoptosis. Conclusion Our findings revealed the mechanism of icaritin in promoting apoptosis and inhibiting proliferation in liver cancer cells. The regulatory mechanism of icaritin in AFP protein down-regulation provides a theoretical and experimental basis for further research into new drugs for the treatment of liver cancer.

show abstract

Section: Discussionmentioning

confidence: 99%

Icaritin promotes apoptosis and inhibits proliferation by down-regulating AFP gene expression in hepatocellular carcinoma

Liu

Xue

et al. 2021

BMC Cancer

View full text Add to dashboard Cite

show abstract

“…Oligomers spanning site A ( Ϫ 208 to Ϫ 193, TGAACCCT TGATCCCA) and site C ( Ϫ 137 to Ϫ 100, ACAGAGCTGATCCTT GAACTCTAAGTTCCACATCGCCA) was inserted into pTZ18R at the Sma I site and amplified before excising by digestion with Hind III plus Eco RI and Eco RI plus Xba I, respectively. These fragments were labeled by incubation with [ ␣ -32 P]-dCTP (NEN) plus the Klenow fragment of DNA polymerase I. Extracts from rat liver were prepared and EMSA studies were performed as described previously (27).…”

Section: Electrophoretic Mobility Shift Assaymentioning

confidence: 99%

Transcription factors and age-related decline in apolipoprotein A-I expression

Nakamura¹,

Fox‐Robichaud

Kikkawa³

et al. 1999

Journal of Lipid Research

View full text Add to dashboard Cite

Apolipoprotein (apo)A-I alone or as a component of high density lipoprotein particles has antiatherogenic properties. The age-dependent decline in abundance of this protein may underlie the higher risk for developing occlusive coronary artery disease (CAD) in older individuals. Similar to humans, expression of rat apoA-I also declines with age. Results in rats showed that levels of serum apoA-I protein, hepatic mRNA, and transcription of the gene were decreased to 39%, 18%, and 38%, respectively, in 180-day-old animals compared to those of newborn rats. These findings suggest that a nuclear mechanism(s) may account for the decline in apoA-I expression. Accordingly, we examined hepatic nuclear binding activity to four specific cis -acting elements of the rat apoA-I promoter. There were age-dependent changes of binding activity to two proximal sites, B and C, but not to the more distal elements, IRCE and A. Decreased B-site binding activity correlated with lower mRNA levels encoding the activator, HNF-3 ␤ . The age-dependent change in the pattern of binding to site C was due to a switch from the activator, HNF-4, to the repressor, ARP-1. In summary, the age-related decline in apoA-I expression may arise from a reduction in the activity of both cis-acting elements, B and

show abstract

“…FFERENTIATION as well as other basic cellular processes are influenced by humoral (Houart et al, 1990;Nakabayashi et al, 1989), intercellular (Fraslin et al, 1985), and matrix-cellular (DiPersio et al, 1991Liu et al, 1991) interactions. However, the fundamental mechanism responsible for phenotypic diversity is the expression of a set of genes specific for a particular cell type.…”

mentioning

confidence: 99%

Expression of hepatic transcription factors during liver development and oval cell differentiation.

Nagy

Bisgaard

Thorgeirsson

1994

The Journal of Cell Biology

213

133

View full text Add to dashboard Cite

Abstract, The oval cells are thought to be the progeny of a liver stem cell compartment and strong evidence now exists indicating that these cells can participate in liver regeneration by differentiating into different hepatic lineages. To better understand the regulation of this process we have studied the expression of liverenriched transcriptional factors (HNFlct and HNF1/3, HNF3ot, HNF3/3, and HNF3"y, HNF4, C/EBP, C/EBP/~, and DBP) in an experimental model of oval cell proliferation and differentiation and compared the expression of these factors to that observed during late stages of hepatic ontogenesis.The steady-state mRNA levels of four (HNFlot, HNF3ot, HNF4, and C/EBP/3) "liver-enriched" transcriptional factors gradually decrease during the late period of embryonic liver development while three factors (HNF1B, HNF3/~, and DBP) increase. In the normal adult rat liver the expression of all the transcription factors are restricted to the hepatocytes. However, during early stages of oval cell proliferation both small and large bile ducts start to express HNFIot and HNF1/~, HNF33,, C/EBP, and DBP but not HNF4. At the later stages all of these factors are also highly expressed in the proliferating oval cells. Expression of HNF4 is first observed when the oval cells differentiate morphologically and functionally into hepatocytes and form basophilic foci. At that time the expression of some of the other factors is also further increased.Based on these data we suggest that the upregulation of the "establishment" factors (HNF1 and -3) may be an important step in oval cell activation. The high levels of these factors in the oval cells and embryonic hepatoblasts further substantiates the similarity between the two cell compartments. Furthermore, the data suggest that HNF4 may be responsible for the final commitment of a small portion of the oval cells to differentiate into hepatocytes which form the basophilic foci and eventually regenerate the liver parenchyma.

show abstract

Transcriptional regulation of α-fetoprotein expression by dexamethasone in human hepatoma cells

Cited by 73 publications

References 34 publications

Icaritin promotes apoptosis and inhibits proliferation by down-regulating AFP gene expression in hepatocellular carcinoma

Icaritin promotes apoptosis and inhibits proliferation by down-regulating AFP gene expression in hepatocellular carcinoma

Transcription factors and age-related decline in apolipoprotein A-I expression

Expression of hepatic transcription factors during liver development and oval cell differentiation.

Contact Info

Product

Resources

About