Transcriptional regulation of the vimentin-encoding gene in mouse myeloid leukemia M1 cells

The zinc finger repressor, ZBP‐89, recruits histone deacetylase 1 to repress vimentin gene expression

“…2A. Similar experiments with the mouse vimentin promoter found a GC‐rich sequence, located close to the transcriptional start site, which also acted as a strong inhibitor of transcription (Nakamura et al . 1995).…”

Targeted Transgene Expression in Müller Glia of Normal and Diseased Retinas Using Lentiviral Vectors

“…60 VIM promoter activity has not been fully characterized in the retina; however, a highly conserved 188-bp fragment of the proximal VIM promoter was reportedly sufficient for effective transcription in myeloid leukemia cells. 38 Both intravitreal and subretinal injection delivery approaches were evaluated with these LV vectors. Regardless of promoter, pseudotype, or animal age at injection (P1-P180), the subretinal approach consistently yielded eGFP expression (Figs.…”

“…The human GFAP promoter (GI 27764743) 37 was released from pGfa2-cLac (gift of Michael Brenner, University of Alabama, Birmingham) by BglII(blunted)/BamHI digest and ligated into a PacI(blunted)/BamHI-digested pFUGW plasmid to construct pFhGFAPGW. The mouse VIM promoter (GI 1262330) 38 was amplified from mouse genomic DNA with the primers mVIM/CF6 (GAATTCGGGATCCTTGGCTGTCCTTGAA) and mVIM/CR6 (TCTA-GAAATCGTAGGAGCGCTGGGGTCT). The amplicon was digested with EcoRI/XbaI and ligated into a similarly digested pCS-CG.SP plasmid that was digested with EcoRI(blunted)/BamHI.…”