Transcriptional refractoriness is dependent on core promoter architecture

Abstract

Genes are often transcribed in random bursts followed by long periods of inactivity. Here we employ the light-activatable white collar complex (WCC) of Neurospora to study the transcriptional bursting with a population approach. Activation of WCC by a light pulse triggers a synchronized wave of transcription from the frequency promoter followed by an extended period (B1 h) during which the promoter is refractory towards restimulation. When challenged by a second light pulse, the newly activated WCC binds to refractory promoters and has the potential to recruit RNA polymerase II (Pol II). However, accumulation of Pol II and phosphorylation of its C-terminal domain repeats at serine 5 are impaired. Our results suggest that refractory promoters carry a physical memory of their recent transcription history. Genome-wide analysis of light-induced transcription suggests that refractoriness is rather widespread and a property of promoter architecture.

RNA polymerase II pausing as a context-dependent reader of the genome

“…Third, while the presence of NELF marks a paused gene, it is possible that it is involved only in a portion of individual transcription initiation events. We suggest that availability of NELF, or a functionally similar factor, may explain recently described events such as transcriptional bursts (Singh et al 2010; Bothma et al 2014) or transcriptional ‘memory’ (Cesbron et al 2015). Consistent with its involvement in regulation, NELF levels are altered in cancer cells (Sun et al 2008).…”

Thiolutin is a zinc chelator that inhibits the Rpn11 and other JAMM metalloproteases

“…As the enzymatic activity of Pol II was not compromised by THL, we performed chromatin immunoprecipitation (ChIP) of Pol II phosphorylated at Ser5 of the C-terminal domain repeats (Pol II S5-P) to assess whether THL affects recruitment of Pol II and initiation of transcription at selected promoters 25 . Quantification of Pol II S5-P occupancy by ChIP-PCR correlated with the results of the RNAseq analysis: although Pol II S5-P enrichment at the promoter regions of frq , vvd, and actin decreased significantly in the presence of THL, recruitment of Pol II to hsp98 and hsp60 increased (Fig.…”

“…The RNA polymerase II ChIP was performed as described 25 . Briefly, light grown cultures were incubated for 40 min in the presence of DMSO and 50 μM THL, respectively.…”

“…Briefly, light grown cultures were incubated for 40 min in the presence of DMSO and 50 μM THL, respectively. Samples were cross-linked for 10 min with 1% formaldehyde and subjected to ChIP with antibodies against Pol II Ser5-P 25 . Precipitated DNA was quantified by qRT–PCR with promoter specific probes: actin: F: tatcatgggcacaagctgat, R: cttacccattgtcgatgacg, Probe: 6-FAM - tgcgttcccgccaacagaag - TAMRA; vvd: F: ttagcctttgccagttaggg, R: tgttggtagggtattatgatggttt, Probe: UPL #41; hsp98: F: cattttgctggtccttgctc, R: cccgttcatctggcagtc, Probe: UPL #14; hsp60: F: gcgttgaccagagcttcc, R: ggatcgtaccttgtgagcaaa, Probe: UPL #3.…”

“…Pelleted nuclei were sonicated in 300 μl IP buffer supplemented with 0.8% SDS (30 s on/30 s off cycles for 40 min) using a Bioruptor (Diagenode Inc.). The chromatin (equivalent of 5×10 5 cells) was then incubated overnight at 4°C with 4 μl affinity purified anti-Pol II Ser2-P antibody 25 and precipitated with salmon sperm DNA blocked protein A-sepharose beads. Beads were washed 5 times with IP buffer and co-precipitated DNA was recovered by boiling for 10 min in 10% Chelex slurry (Bio-Rad) and treatment with Proteinase K (150 μg/ml, NEB) at 55°C for 30 min.…”