Transcription-dependent nucleolar cap localization and possible nuclear function of DExH RNA helicase RHAU

Iwamoto, Fumiko; Stadler, Michael; Chalupníková, Kateřina; Oakeley, Edward J.; Nagamine, Yoshikuni

doi:10.1016/j.yexcr.2008.01.006

Cited by 46 publications

(75 citation statements)

References 53 publications

Supporting

Mentioning

Contrasting

Order By: Relevance

“…The fact that many cells can readily take up G4DNA indicates that this mechanism may also allow the cell to respond to its external environment as well as internal stress (67,72). Although our results suggest important roles for G4DNA in the regulation of cytoplasmic cellular processes, other studies have suggested roles for G4DNA in modulating transcription through the binding of helicases such as DHX36 (30,96,97), the RecQ family helicases (98,99), and the XPB and XPD helicases (75). It is possible that any G4DNA-binding protein may be regulated by freely diffusing G4DNA, leading to various cellular responses based on the large number of proteins that are reported to have G4DNA binding capacity (4, 100 -102).…”

Section: Discussionmentioning

confidence: 56%

See 1 more Smart Citation

Evidence That G-quadruplex DNA Accumulates in the Cytoplasm and Participates in Stress Granule Assembly in Response to Oxidative Stress

Byrd¹,

Zybailov

Maddukuri³

et al. 2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

Cells engage numerous signaling pathways in response to oxidative stress that together repair macromolecular damage or direct the cell toward apoptosis. As a result of DNA damage, mitochondrial DNA or nuclear DNA has been shown to enter the cytoplasm where it binds to "DNA sensors," which in turn initiate signaling cascades. Here we report data that support a novel signaling pathway in response to oxidative stress mediated by specific guanine-rich sequences that can fold into G-quadruplex DNA (G4DNA). In response to oxidative stress, we demonstrate that sequences capable of forming G4DNA appear at increasing levels in the cytoplasm and participate in assembly of stress granules. Identified proteins that bind to endogenous G4DNA in the cytoplasm are known to modulate mRNA translation and participate in stress granule formation. Consistent with these findings, stress granule formation is known to regulate mRNA translation during oxidative stress. We propose a signaling pathway whereby cells can rapidly respond to DNA damage caused by oxidative stress. Guanine-rich sequences that are excised from damaged genomic DNA are proposed to enter the cytoplasm where they can regulate translation through stress granule formation. This newly proposed role for G4DNA provides an additional molecular explanation for why such sequences are prevalent in the human genome.

show abstract

Section: Discussionmentioning

confidence: 56%

“…DHX36 is a multifunctional enzyme involved in transcription (30) and translation (31) and has been suggested to serve as a sensor for DNA in the cytoplasm (32). Surprisingly, other enriched proteins are ELAV1/HUR, YB-1/ YBOX1, and TIA1, as well as other proteins known to regulate translation and assemble into stress granules (21,24).…”

Section: Resultsmentioning

confidence: 99%

Evidence That G-quadruplex DNA Accumulates in the Cytoplasm and Participates in Stress Granule Assembly in Response to Oxidative Stress

Byrd¹,

Zybailov

Maddukuri³

et al. 2016

Journal of Biological Chemistry

View full text Add to dashboard Cite

show abstract

“…Quadruplex Production and Purification-Synthetic hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] RNA (5Ј-GGGUUGCGGAGGGUGGGCCU-3Ј, where the underlining highlights the guanines; Integrated DNA Technologies) was dissolved in 20 mM HEPES, pH 7.5, 100 mM KCl, 1 mM EDTA at a concentration of 5 M. RNA was heated to 95°C for 5 min, allowed to passively cool to room temperature outside the heat bath, and then purified by SEC on a HiLoad Superdex TM 75 26/60 size exclusion chromatography column (Ä KTA FPLC , GE Healthcare). Synthetic DNA quadruplexes (Alpha DNA, Canada) were dissolved in the above HEPES buffer but without adding EDTA, heated to 95°C, and allowed to cool slowly to room temperature inside the metal heat block or water bath.…”

Section: Methodsmentioning

confidence: 99%

“…All DNA synthesis batches exhibited the same result. Extinction coefficients (⑀ 260 nm ) were calculated from the sequence using IDT SciTools (PrimerQuest program, Integrated DNA Technologies) and corrected for hyperchromicity using the absorption spectra at 20 and 80°C: hTR [1][2][3][4][5][6][7][8][9][10][11][12][13][14][15][16][17][18][19][20] (22) and dsRNA (HIV-1 trans-activation response element, GGUCUCUCUGGUUAAGCCAGAUCUGAGCCUG-GGAGCUCUCUGGCUAACUAGGGAACC) (29) controls were used.…”

Section: Methodsmentioning

confidence: 99%

See 1 more Smart Citation

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

Meier

Patel

Booy

et al. 2013

Journal of Biological Chemistry

View full text Add to dashboard Cite

Background:The helicase RHAU requires an N-terminal extension to bind quadruplex structures. Results: This extension adopts an elongated shape and interacts with the guanine tetrad face of quadruplexes. Conclusion: We provide a basis for the understanding of quadruplex binding by the N-terminal domain. Significance: The N-terminal region does not require the 2Ј-OH of the ribose to mediate the protein-quadruplex interaction.

show abstract

Histone deacetylase inhibitor MS-275 stimulates bone formation in part by enhancing Dhx36-mediated TNAP transcription

Kim

Lee

Bae

et al. 2011

Journal of Bone and Mineral Research

View full text Add to dashboard Cite

Histone deacetylases (HDACs) deacetylate both histones and nonhistone proteins and play a key role in the regulation of physiologic and aberrant gene expression. Inhibition of HDACs has emerged as a promising therapeutic target for cancer and neurologic diseases. In this study we investigated the osteogenic effect and mechanism of action of MS-275, a class I HDAC inhibitor with preference for HDAC1. Both local and systemic administration of MS-275 stimulated bone regeneration in animal models. MS-275 stimulated mRNA expression and activity of the early osteogenic marker tissue-nonspecific alkaline phosphatase (TNAP) in bone tissue and osteogenic cells. By using a series of TNAP promoter deletion constructs and a DNA affinity precipitation assay, we identified DExH-box helicase Dhx36 as a factor that binds to the MS-275 response element in the TNAP promoter. We also found that Dhx36 binding to the MS-275 response element is crucial for MS-275 induction of TNAP transcription. Dhx36 physically interacted with a subset of HDACs (HDAC1 and -4) whose protein levels were downregulated by MS-275, and forced expression of these HDACs blunted the stimulatory effects of MS-275 by a deacetylase activity-independent mechanism(s). Taken together, the results of our study show that MS-275 induces TNAP transcription by decreasing the interaction of HDAC1/4 with Dhx36, which can at least in part contribute to the bone anabolic effects of MS-275.

show abstract

Transcription-dependent nucleolar cap localization and possible nuclear function of DExH RNA helicase RHAU

Cited by 46 publications

References 53 publications

Evidence That G-quadruplex DNA Accumulates in the Cytoplasm and Participates in Stress Granule Assembly in Response to Oxidative Stress

Evidence That G-quadruplex DNA Accumulates in the Cytoplasm and Participates in Stress Granule Assembly in Response to Oxidative Stress

Binding of G-quadruplexes to the N-terminal Recognition Domain of the RNA Helicase Associated with AU-rich Element (RHAU)

Histone deacetylase inhibitor MS-275 stimulates bone formation in part by enhancing Dhx36-mediated TNAP transcription

Contact Info

Product

Resources

About