Toxoplasma Co-infection Prevents Th2 Differentiation and Leads to a Helminth-Specific Th1 Response

Abstract

Nematode infections, in particular gastrointestinal nematodes, are widespread and co-infections with other parasites and pathogens are frequently encountered in humans and animals. To decipher the immunological effects of a widespread protozoan infection on the anti-helminth immune response we studied a co-infection with the enteric nematode Heligmosomoides polygyrus in mice previously infected with Toxoplasma gondii. Protective immune responses against nematodes are dependent on parasite-specific Th2 responses associated with IL-4, IL-5, IL-13, IgE, and IgG1 antibodies. In contrast, Toxoplasma gondii infection elicits a strong and protective Th1 immune response characterized by IFN-γ, IL-12, and IgG2a antibodies. Co-infected animals displayed significantly higher worm fecundity although worm burden remained unchanged. In line with this, the Th2 response to H. polygyrus in co-infected animals showed a profound reduction of IL-4, IL-5, IL-13, and GATA-3 expressing T cells. Co-infection also resulted in the lack of eosinophilia and reduced expression of the Th2 effector molecule RELM-β in intestinal tissue. In contrast, the Th1 response to the protozoan parasite was not diminished and parasitemia of T. gondii was unaffected by concurrent helminth infection. Importantly, H. polygyrus specific restimulation of splenocytes revealed H. polygyrus-reactive CD4+ T cells that produce a significant amount of IFN-γ in co-infected animals. This was not observed in animals infected with the nematode alone. Increased levels of H. polygyrus-specific IgG2a antibodies in co-infected mice mirrored this finding. This study suggests that polarization rather than priming of naive CD4+ T cells is disturbed in mice previously infected with T. gondii. In conclusion, a previous T. gondii infection limits a helminth-specific Th2 immune response while promoting a shift toward a Th1-type immune response.

Manipulation of the balance between Th2 and Th2/1 hybrid cells affects parasite nematode fitness in mice

“…Cell isolation, DC generation, antigen loading, and CD40‐L detection were performed as described recently . Antigen extracts of adult parasites were generated as described before .…”

“…Duodenal tissue (0.5 cm) was frozen in liquid nitrogen and stored at −80°C. RNA isolation, reverse transcription and real‐time PCR were described earlier . Target gene expression was normalized against the housekeeper GAPDH.…”

“…Target gene expression was normalized against the housekeeper GAPDH. The following and previously published primers were used. iNOS: ATGGACCAGTATAAGGCAAGC and CAATATAGGCTCATCCAGAGC; RELM‐α: TCCCAGTGAATACTGATGAGA and CCACTCTGGATCTCCCAAGA; GAPDH: TGGATTTGGACGCATTGGTC and TTTGCACTGGTACGTGTTGAT.…”

“…IFN‐γ was detected in supernatants of 1 × 10 6 cells stimulated with 50 μg/mL H. polygyrus antigen for 5 days using an ELISA kit (eBioscience, San Diego, CA, USA) according to the manufacturer's protocol. Serum antibodies were detected as described earlier .…”

“…The control of intestinal nematodes depends on a suite of IL‐4/‐13‐driven effector mechanisms, eventually permitting worm expulsion and protection against reinfection . Th2 responses are sensitive to counter‐regulation by IFN‐γ and IL‐12, evident as impaired anti‐helminth immunity in coinfections with protozoan parasites eliciting Th1 reactions . Furthermore, the resistance of mouse lines against enteric nematodes correlates with the magnitude of Th2 responses and relatively high levels of IFN‐γ production in Th1‐prone mice, such as the C57BL/6 line, are linked to susceptibility .…”